ID: 1065431090

View in Genome Browser
Species Human (GRCh38)
Location 10:25656685-25656707
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5750
Summary {0: 4, 1: 401, 2: 968, 3: 1239, 4: 3138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065431090 Original CRISPR AATATCTAAAAGAGTATAAT TGG (reversed) Intergenic
Too many off-targets to display for this crispr