ID: 1065431559

View in Genome Browser
Species Human (GRCh38)
Location 10:25662055-25662077
Sequence AAGGAGAGTGTAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065431559_1065431564 12 Left 1065431559 10:25662055-25662077 CCCACAGTCACTACACTCTCCTT No data
Right 1065431564 10:25662090-25662112 AGTTTTGCCTCTATGCCATGTGG No data
1065431559_1065431566 23 Left 1065431559 10:25662055-25662077 CCCACAGTCACTACACTCTCCTT No data
Right 1065431566 10:25662101-25662123 TATGCCATGTGGCTGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065431559 Original CRISPR AAGGAGAGTGTAGTGACTGT GGG (reversed) Intergenic
No off target data available for this crispr