ID: 1065442196

View in Genome Browser
Species Human (GRCh38)
Location 10:25764123-25764145
Sequence GCGATGTTTACATAACGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065442196_1065442199 0 Left 1065442196 10:25764123-25764145 CCTGCGCGTTATGTAAACATCGC No data
Right 1065442199 10:25764146-25764168 ACCTGGTCCAACCTATCTTTGGG No data
1065442196_1065442198 -1 Left 1065442196 10:25764123-25764145 CCTGCGCGTTATGTAAACATCGC No data
Right 1065442198 10:25764145-25764167 CACCTGGTCCAACCTATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065442196 Original CRISPR GCGATGTTTACATAACGCGC AGG (reversed) Intergenic
No off target data available for this crispr