ID: 1065446996

View in Genome Browser
Species Human (GRCh38)
Location 10:25813146-25813168
Sequence CAGAATGTTGATATTGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065446996_1065447001 23 Left 1065446996 10:25813146-25813168 CCCGGCCCAATATCAACATTCTG No data
Right 1065447001 10:25813192-25813214 ATAATACAGCAACGCTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065446996 Original CRISPR CAGAATGTTGATATTGGGCC GGG (reversed) Intergenic
No off target data available for this crispr