ID: 1065447451

View in Genome Browser
Species Human (GRCh38)
Location 10:25817925-25817947
Sequence TCATTTCTACAGATTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065447445_1065447451 30 Left 1065447445 10:25817872-25817894 CCTTCACATTTTAATGTGGCTAA No data
Right 1065447451 10:25817925-25817947 TCATTTCTACAGATTGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065447451 Original CRISPR TCATTTCTACAGATTGGGCA AGG Intergenic
No off target data available for this crispr