ID: 1065447790

View in Genome Browser
Species Human (GRCh38)
Location 10:25821294-25821316
Sequence CAGCTCTTCCTGTGCATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065447782_1065447790 26 Left 1065447782 10:25821245-25821267 CCTGAAATTTGTAAATTAATACG No data
Right 1065447790 10:25821294-25821316 CAGCTCTTCCTGTGCATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065447790 Original CRISPR CAGCTCTTCCTGTGCATCAA GGG Intergenic
No off target data available for this crispr