ID: 1065447790 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:25821294-25821316 |
| Sequence | CAGCTCTTCCTGTGCATCAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1065447782_1065447790 | 26 | Left | 1065447782 | 10:25821245-25821267 | CCTGAAATTTGTAAATTAATACG | No data | ||
| Right | 1065447790 | 10:25821294-25821316 | CAGCTCTTCCTGTGCATCAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1065447790 | Original CRISPR | CAGCTCTTCCTGTGCATCAA GGG | Intergenic | ||
| No off target data available for this crispr | |||||