ID: 1065452364

View in Genome Browser
Species Human (GRCh38)
Location 10:25872381-25872403
Sequence CTGTTTAAGCCATCAGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065452363_1065452364 2 Left 1065452363 10:25872356-25872378 CCTGAACAAAGTGCAGTGTGGAC No data
Right 1065452364 10:25872381-25872403 CTGTTTAAGCCATCAGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065452364 Original CRISPR CTGTTTAAGCCATCAGATGT AGG Intergenic
No off target data available for this crispr