ID: 1065452759

View in Genome Browser
Species Human (GRCh38)
Location 10:25875804-25875826
Sequence TCTTCTCAGTGTACCCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065452759_1065452761 -9 Left 1065452759 10:25875804-25875826 CCTTCTTGGGTACACTGAGAAGA No data
Right 1065452761 10:25875818-25875840 CTGAGAAGAGATATTGTCAAGGG No data
1065452759_1065452763 1 Left 1065452759 10:25875804-25875826 CCTTCTTGGGTACACTGAGAAGA No data
Right 1065452763 10:25875828-25875850 ATATTGTCAAGGGATTATGGCGG No data
1065452759_1065452764 2 Left 1065452759 10:25875804-25875826 CCTTCTTGGGTACACTGAGAAGA No data
Right 1065452764 10:25875829-25875851 TATTGTCAAGGGATTATGGCGGG No data
1065452759_1065452760 -10 Left 1065452759 10:25875804-25875826 CCTTCTTGGGTACACTGAGAAGA No data
Right 1065452760 10:25875817-25875839 ACTGAGAAGAGATATTGTCAAGG No data
1065452759_1065452762 -2 Left 1065452759 10:25875804-25875826 CCTTCTTGGGTACACTGAGAAGA No data
Right 1065452762 10:25875825-25875847 GAGATATTGTCAAGGGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065452759 Original CRISPR TCTTCTCAGTGTACCCAAGA AGG (reversed) Intergenic