ID: 1065452764

View in Genome Browser
Species Human (GRCh38)
Location 10:25875829-25875851
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065452759_1065452764 2 Left 1065452759 10:25875804-25875826 CCTTCTTGGGTACACTGAGAAGA No data
Right 1065452764 10:25875829-25875851 TATTGTCAAGGGATTATGGCGGG No data
1065452757_1065452764 10 Left 1065452757 10:25875796-25875818 CCCTTTGGCCTTCTTGGGTACAC No data
Right 1065452764 10:25875829-25875851 TATTGTCAAGGGATTATGGCGGG No data
1065452758_1065452764 9 Left 1065452758 10:25875797-25875819 CCTTTGGCCTTCTTGGGTACACT No data
Right 1065452764 10:25875829-25875851 TATTGTCAAGGGATTATGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065452764 Original CRISPR TATTGTCAAGGGATTATGGC GGG Intergenic
No off target data available for this crispr