ID: 1065454632

View in Genome Browser
Species Human (GRCh38)
Location 10:25894154-25894176
Sequence TCATTACCAGAGATTGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065454630_1065454632 -2 Left 1065454630 10:25894133-25894155 CCAGTATTTGTTGGGTGCCAGTC No data
Right 1065454632 10:25894154-25894176 TCATTACCAGAGATTGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065454632 Original CRISPR TCATTACCAGAGATTGTGCT AGG Intergenic
No off target data available for this crispr