ID: 1065455817

View in Genome Browser
Species Human (GRCh38)
Location 10:25905559-25905581
Sequence GTGCAAAACCACAGTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065455817_1065455820 -5 Left 1065455817 10:25905559-25905581 CCCTCCTGACTGTGGTTTTGCAC No data
Right 1065455820 10:25905577-25905599 TGCACTCCAAAGCTTCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065455817 Original CRISPR GTGCAAAACCACAGTCAGGA GGG (reversed) Intergenic
No off target data available for this crispr