ID: 1065457179

View in Genome Browser
Species Human (GRCh38)
Location 10:25919030-25919052
Sequence TCCAGGACTGTCCTGGAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065457171_1065457179 24 Left 1065457171 10:25918983-25919005 CCAGAGTCAATCCCTTGGTGGGG No data
Right 1065457179 10:25919030-25919052 TCCAGGACTGTCCTGGAATTGGG No data
1065457175_1065457179 12 Left 1065457175 10:25918995-25919017 CCTTGGTGGGGGTGAGCAGAGTT No data
Right 1065457179 10:25919030-25919052 TCCAGGACTGTCCTGGAATTGGG No data
1065457174_1065457179 13 Left 1065457174 10:25918994-25919016 CCCTTGGTGGGGGTGAGCAGAGT No data
Right 1065457179 10:25919030-25919052 TCCAGGACTGTCCTGGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065457179 Original CRISPR TCCAGGACTGTCCTGGAATT GGG Intergenic
No off target data available for this crispr