ID: 1065457765

View in Genome Browser
Species Human (GRCh38)
Location 10:25925544-25925566
Sequence GCTATGATGTCCAATGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065457765_1065457770 5 Left 1065457765 10:25925544-25925566 CCTGGGACATTGGACATCATAGC No data
Right 1065457770 10:25925572-25925594 GTTCTTGGGTCTCAGAAGTCAGG No data
1065457765_1065457772 19 Left 1065457765 10:25925544-25925566 CCTGGGACATTGGACATCATAGC No data
Right 1065457772 10:25925586-25925608 GAAGTCAGGACTTACACCACGGG No data
1065457765_1065457773 28 Left 1065457765 10:25925544-25925566 CCTGGGACATTGGACATCATAGC No data
Right 1065457773 10:25925595-25925617 ACTTACACCACGGGTTCTCCTGG No data
1065457765_1065457767 -10 Left 1065457765 10:25925544-25925566 CCTGGGACATTGGACATCATAGC No data
Right 1065457767 10:25925557-25925579 ACATCATAGCTCCTGGTTCTTGG No data
1065457765_1065457768 -9 Left 1065457765 10:25925544-25925566 CCTGGGACATTGGACATCATAGC No data
Right 1065457768 10:25925558-25925580 CATCATAGCTCCTGGTTCTTGGG No data
1065457765_1065457771 18 Left 1065457765 10:25925544-25925566 CCTGGGACATTGGACATCATAGC No data
Right 1065457771 10:25925585-25925607 AGAAGTCAGGACTTACACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065457765 Original CRISPR GCTATGATGTCCAATGTCCC AGG (reversed) Intergenic
No off target data available for this crispr