ID: 1065464438

View in Genome Browser
Species Human (GRCh38)
Location 10:26004049-26004071
Sequence TAGAACAAAAGCCATTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065464432_1065464438 8 Left 1065464432 10:26004018-26004040 CCTTCAATCCTTCCTTTCTTTAT 0: 1
1: 0
2: 40
3: 1954
4: 9992
Right 1065464438 10:26004049-26004071 TAGAACAAAAGCCATTGGGTGGG No data
1065464431_1065464438 9 Left 1065464431 10:26004017-26004039 CCCTTCAATCCTTCCTTTCTTTA No data
Right 1065464438 10:26004049-26004071 TAGAACAAAAGCCATTGGGTGGG No data
1065464434_1065464438 -4 Left 1065464434 10:26004030-26004052 CCTTTCTTTATGAATAATTTAGA 0: 1
1: 0
2: 2
3: 47
4: 638
Right 1065464438 10:26004049-26004071 TAGAACAAAAGCCATTGGGTGGG No data
1065464433_1065464438 0 Left 1065464433 10:26004026-26004048 CCTTCCTTTCTTTATGAATAATT No data
Right 1065464438 10:26004049-26004071 TAGAACAAAAGCCATTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065464438 Original CRISPR TAGAACAAAAGCCATTGGGT GGG Intronic
No off target data available for this crispr