ID: 1065466536 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:26030106-26030128 |
| Sequence | GGGAAGAATGGGGCTGAGTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1065466536_1065466541 | -5 | Left | 1065466536 | 10:26030106-26030128 | CCACACTCAGCCCCATTCTTCCC | No data | ||
| Right | 1065466541 | 10:26030124-26030146 | TTCCCACCACACCTCGGTCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1065466536 | Original CRISPR | GGGAAGAATGGGGCTGAGTG TGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||