ID: 1065466536

View in Genome Browser
Species Human (GRCh38)
Location 10:26030106-26030128
Sequence GGGAAGAATGGGGCTGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065466536_1065466541 -5 Left 1065466536 10:26030106-26030128 CCACACTCAGCCCCATTCTTCCC No data
Right 1065466541 10:26030124-26030146 TTCCCACCACACCTCGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065466536 Original CRISPR GGGAAGAATGGGGCTGAGTG TGG (reversed) Intronic
No off target data available for this crispr