ID: 1065467979

View in Genome Browser
Species Human (GRCh38)
Location 10:26045698-26045720
Sequence GCTCCTTTTGCTCCCCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065467974_1065467979 -3 Left 1065467974 10:26045678-26045700 CCCCGGTCCTCCTTTCATCTGCT 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1065467979 10:26045698-26045720 GCTCCTTTTGCTCCCCAAGCAGG No data
1065467977_1065467979 -10 Left 1065467977 10:26045685-26045707 CCTCCTTTCATCTGCTCCTTTTG 0: 1
1: 2
2: 14
3: 65
4: 465
Right 1065467979 10:26045698-26045720 GCTCCTTTTGCTCCCCAAGCAGG No data
1065467973_1065467979 1 Left 1065467973 10:26045674-26045696 CCTTCCCCGGTCCTCCTTTCATC 0: 1
1: 1
2: 4
3: 41
4: 491
Right 1065467979 10:26045698-26045720 GCTCCTTTTGCTCCCCAAGCAGG No data
1065467975_1065467979 -4 Left 1065467975 10:26045679-26045701 CCCGGTCCTCCTTTCATCTGCTC 0: 1
1: 0
2: 1
3: 27
4: 346
Right 1065467979 10:26045698-26045720 GCTCCTTTTGCTCCCCAAGCAGG No data
1065467976_1065467979 -5 Left 1065467976 10:26045680-26045702 CCGGTCCTCCTTTCATCTGCTCC 0: 1
1: 1
2: 25
3: 101
4: 792
Right 1065467979 10:26045698-26045720 GCTCCTTTTGCTCCCCAAGCAGG No data
1065467971_1065467979 29 Left 1065467971 10:26045646-26045668 CCTCAGGAAACAGAATCTCATTT 0: 1
1: 1
2: 12
3: 110
4: 519
Right 1065467979 10:26045698-26045720 GCTCCTTTTGCTCCCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065467979 Original CRISPR GCTCCTTTTGCTCCCCAAGC AGG Intronic
No off target data available for this crispr