ID: 1065468817

View in Genome Browser
Species Human (GRCh38)
Location 10:26055079-26055101
Sequence TGGATAGAAGCTGCTGCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065468817_1065468822 12 Left 1065468817 10:26055079-26055101 CCTAAGGCAGCAGCTTCTATCCA 0: 1
1: 0
2: 2
3: 20
4: 231
Right 1065468822 10:26055114-26055136 CTAGAGCTACAGCTCTCTCTTGG No data
1065468817_1065468823 19 Left 1065468817 10:26055079-26055101 CCTAAGGCAGCAGCTTCTATCCA 0: 1
1: 0
2: 2
3: 20
4: 231
Right 1065468823 10:26055121-26055143 TACAGCTCTCTCTTGGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065468817 Original CRISPR TGGATAGAAGCTGCTGCCTT AGG (reversed) Intronic
901036051 1:6336952-6336974 TGGAGAAAAGCTACAGCCTTGGG + Intronic
901763857 1:11487832-11487854 CGGATGGAAGCTGCTGCCTCAGG + Intronic
902527260 1:17067358-17067380 GGGACAGCAGCTCCTGCCTTTGG - Exonic
902999253 1:20253110-20253132 TGGATAAAAGCTGTGGTCTTTGG + Intergenic
903833905 1:26190479-26190501 TGGAGAGAAGCTCCTCCCATTGG - Intergenic
904173941 1:28612059-28612081 TGTCAAGAAGCTGTTGCCTTGGG - Intronic
904629903 1:31833192-31833214 TGGATAGCAGCTGCTGACAGCGG + Intergenic
905915949 1:41684361-41684383 TGGTCAGCAGCTGCAGCCTTGGG - Intronic
906291007 1:44619128-44619150 TGGATGGAAACTCCTGCCTGAGG - Intronic
908164686 1:61446597-61446619 TGGATAGCATCTGCCACCTTTGG - Intronic
910609871 1:89129248-89129270 TGGAATGAAGTTACTGCCTTTGG - Intronic
911687075 1:100789908-100789930 TGAGTAGAGGCTGCAGCCTTAGG + Intergenic
912271602 1:108216161-108216183 GAAAGAGAAGCTGCTGCCTTGGG + Intergenic
913393682 1:118342832-118342854 TGGGTAGGAGCTGTGGCCTTAGG + Intergenic
915304312 1:154969086-154969108 TGGAAGGTTGCTGCTGCCTTTGG - Intronic
916845840 1:168649258-168649280 GGGAAAGGAGCTGCTACCTTGGG - Intergenic
917880681 1:179332956-179332978 TTGATAGAAGGTGCTGCCACTGG - Intronic
919134384 1:193489703-193489725 AGGACAGAAGCTCCTGCGTTTGG + Intergenic
920766806 1:208841508-208841530 AGGATAGAATCTACTCCCTTGGG + Intergenic
923518520 1:234717988-234718010 AGGATGTGAGCTGCTGCCTTGGG + Intergenic
923605818 1:235441617-235441639 TAGATAGAAGATTCTGCCCTTGG + Intronic
923879671 1:238089868-238089890 TACTTAGAAGCTGCTGCTTTTGG + Intergenic
924410693 1:243802117-243802139 TGGAAATGAGCTGCGGCCTTTGG - Intronic
924840398 1:247704800-247704822 TAGATAGTAGGTGCTGCTTTTGG + Intergenic
1064413987 10:15133004-15133026 TGGATAGGCGCTGCTGACTTGGG - Intronic
1065468817 10:26055079-26055101 TGGATAGAAGCTGCTGCCTTAGG - Intronic
1067302348 10:45023453-45023475 TGGATAAAGGCTGCTCCCTGTGG - Intergenic
1068499261 10:57822276-57822298 TGTTTAGAAGTTGCTGCCTCAGG - Intergenic
1069075795 10:64037242-64037264 AGCAAAGAAGCTGCTGCTTTGGG - Intergenic
1070523239 10:77273040-77273062 TGAATAGATGCTTCTGCTTTAGG - Intronic
1071765137 10:88655613-88655635 TAGACAGAATCTGCTGCCCTAGG - Intergenic
1072373742 10:94793399-94793421 TGGCAAGGAGCTGCTTCCTTTGG + Intronic
1072792769 10:98330463-98330485 TGGATAAAAGCTGAGGTCTTCGG + Intergenic
1073482646 10:103796629-103796651 TGTACAAAAGCTGCTGCCTGGGG + Intronic
1074682005 10:115916755-115916777 CTGATACAAGCTGCAGCCTTGGG + Intronic
1076982939 11:214625-214647 TGTTCAGAAGCTGCTGCCTGAGG + Exonic
1077328432 11:1973558-1973580 TGGAGAGAAGGGGCTGCCCTCGG + Intronic
1078509924 11:11977499-11977521 TAGAGACAAGCTGCTTCCTTTGG - Intronic
1079371215 11:19854512-19854534 TGGGTAGGAGCTGCCCCCTTTGG + Intronic
1079745590 11:24124951-24124973 TGGAGAGAAGGAGCTGCCCTGGG - Intergenic
1079844107 11:25442611-25442633 GGGATAGAAGTTGTGGCCTTAGG - Intergenic
1081484194 11:43515430-43515452 TGGATAGAAGCAGGTGGCTGGGG - Intergenic
1085272486 11:75278498-75278520 GGGATAGAAGCTCCTACCTGAGG + Intronic
1087021739 11:93610136-93610158 AGGGTACAAGCTGCTGCCTCAGG + Intergenic
1087554695 11:99701815-99701837 TTCATAGATTCTGCTGCCTTTGG + Intronic
1088954467 11:114605448-114605470 TGGATAACAACTGTTGCCTTTGG + Intergenic
1090067545 11:123516245-123516267 TGGATGGAAGCTGAACCCTTTGG + Intergenic
1091274280 11:134339850-134339872 TGGATAGAAGTTGTTGAATTGGG + Intronic
1202811410 11_KI270721v1_random:28737-28759 TGGAGAGAAGGGGCTGCCCTCGG + Intergenic
1092994244 12:13933317-13933339 TGGATAGAAGATGCTGCCCCAGG - Intronic
1098323199 12:69272079-69272101 TGGATTGAAAGTGCTGCTTTTGG + Exonic
1098518064 12:71401507-71401529 TGGAGAGAACCTAGTGCCTTGGG - Intronic
1100428585 12:94509984-94510006 AGGATAGCAGCTTCTGCTTTGGG - Intergenic
1103587092 12:121963897-121963919 TGGAGGGGAGCTTCTGCCTTTGG + Intronic
1103606356 12:122088604-122088626 TGGGTAGAAGCAGCCGCCTGGGG + Intronic
1103662251 12:122529963-122529985 TGCATAGAACCTGGTTCCTTGGG - Intronic
1103865648 12:124049901-124049923 TTGATAGCATCAGCTGCCTTTGG + Intronic
1103928448 12:124436447-124436469 TGGATGGGGACTGCTGCCTTGGG - Intronic
1105460306 13:20579395-20579417 AGGAGAGAATCTGCTGCCTGGGG - Intronic
1106418471 13:29565866-29565888 TGTATAGATGCTGCTGCGTTAGG - Intronic
1106544394 13:30717660-30717682 TGGACAGAAGCTCCTGCACTAGG - Intronic
1107046790 13:36001375-36001397 TGGAAAGAACCAGCTGCCTATGG + Intronic
1110497976 13:76190942-76190964 TGGGTAGACACTGCTGGCTTGGG - Intergenic
1113483766 13:110640172-110640194 AGGAAAGAAGGGGCTGCCTTGGG - Intergenic
1113988505 13:114339151-114339173 TGGATGGAGGCTGCTGCCAGAGG - Intergenic
1115197703 14:30819487-30819509 CTGATAGAAGTTGCAGCCTTTGG - Intergenic
1115520525 14:34228944-34228966 TGGGTGCAAGCTGCTGCCTGTGG - Intronic
1116636822 14:47407517-47407539 TGGATATAAATTGCTACCTTTGG - Intronic
1118163164 14:63311062-63311084 TTGACAGGAGCTGCAGCCTTTGG - Intergenic
1121971198 14:98358066-98358088 TGGACTGAAGCTGCTACCTATGG + Intergenic
1122346896 14:101066384-101066406 TGGGTGGGAGCTGGTGCCTTGGG + Intergenic
1127763729 15:62165031-62165053 GGGAGAGAAGCTGCTGAGTTTGG + Intronic
1128047421 15:64631186-64631208 TGGGTAGAGGCTGCTGCTTCAGG + Intronic
1128847910 15:70917706-70917728 TGGAAAGGAGCTGCTCCCTGTGG + Intronic
1130092591 15:80833479-80833501 TGGATATAACCTGATTCCTTTGG - Intronic
1130813331 15:87405260-87405282 GTGATAGAGGATGCTGCCTTGGG - Intergenic
1130891431 15:88137048-88137070 TCCTTAGAAGCTGCTGCCATAGG + Intronic
1135238650 16:20782895-20782917 GGGATAGAAGCTGCTGCACTTGG - Intronic
1138039765 16:53650594-53650616 TTGAAAGAATCTGCAGCCTTTGG + Intronic
1139203387 16:65002359-65002381 TGAATAGAACCTTCTGCTTTGGG - Intronic
1141156323 16:81599661-81599683 GGGATGGAAGTTGCTGTCTTGGG + Intronic
1142491689 17:283815-283837 TGGAGAGAGGCTGCTCTCTTGGG - Intronic
1144157737 17:12523229-12523251 TGGTTAGAATGTCCTGCCTTGGG - Intergenic
1145064012 17:19749806-19749828 TTGCTGGAAGCTGCAGCCTTTGG - Intergenic
1145141422 17:20451376-20451398 AGGATGGAAGCTGATGCCTCTGG - Intronic
1146968660 17:37054641-37054663 CGGACAGTAACTGCTGCCTTCGG + Intronic
1147833977 17:43316985-43317007 TGGAAGGCAGCTGCAGCCTTAGG - Intergenic
1148747773 17:49927938-49927960 TGGAAGGAAGCTGCGGGCTTGGG + Intergenic
1148828644 17:50414132-50414154 TGGGAAGACTCTGCTGCCTTGGG - Intergenic
1148987030 17:51631909-51631931 TGGCTAGTAGCTGCTGTATTGGG + Intronic
1152447311 17:80353323-80353345 TGGAAGGAAGGGGCTGCCTTGGG + Intronic
1155320392 18:24613112-24613134 TGGATGGAAGCTGAGGCCTAGGG - Intergenic
1155739465 18:29269599-29269621 TGGATAGGTGTTGCTGCTTTAGG + Intergenic
1156356599 18:36347401-36347423 TTGATAGAGGCTCTTGCCTTTGG + Intronic
1156600565 18:38600700-38600722 TGGAAAGAAAATGTTGCCTTTGG - Intergenic
1157103118 18:44747989-44748011 TGGATCTATGCTTCTGCCTTGGG + Intronic
1157108727 18:44799713-44799735 TTGATAGGAGCTGTGGCCTTTGG + Intronic
1157889753 18:51404421-51404443 GGGAGAGAAGCAGCTGCCTCAGG - Intergenic
1158598644 18:58838388-58838410 TGGCCACAAGCTGCTGCCCTGGG + Intergenic
1159984755 18:74828898-74828920 AGTATAGTACCTGCTGCCTTAGG + Intronic
1162040235 19:7966579-7966601 GGGAGAAAAGATGCTGCCTTAGG - Intronic
1166006924 19:39914446-39914468 TGGATTTAAGCTGGTGCTTTAGG - Intronic
1166283699 19:41810871-41810893 TAGATGGAAGCTGCTGTCCTGGG - Exonic
924959351 2:19921-19943 TGGATGGAAGCTGCTGCCGGAGG + Intergenic
925685659 2:6470466-6470488 TGGATGCAGGCTGCTGCCTCTGG + Intergenic
925707714 2:6702944-6702966 TGGATTGAAGATGTTTCCTTGGG + Intergenic
926685320 2:15693440-15693462 TGAATAGGAGCTGCAGACTTAGG - Intronic
927075257 2:19571151-19571173 TAGAAAGAAGCTGCTCCCCTAGG - Intergenic
927925564 2:27011078-27011100 TGGAGAGAAGGTGATGTCTTAGG - Intronic
928043398 2:27901662-27901684 TGGAAGGAAGCTGCTGCCCTGGG + Intronic
928404785 2:31006427-31006449 TTAATAGAAGCACCTGCCTTGGG - Intronic
929992694 2:46803037-46803059 ATGATAGAAGCTGCCTCCTTAGG + Intergenic
930293590 2:49526871-49526893 TAGACTGAAGCTGCTGACTTAGG - Intergenic
932431615 2:71678939-71678961 TGGATAGAAGCTGGTGACAGAGG + Intronic
932523492 2:72439036-72439058 TGCTTAGAAGCTGTTACCTTGGG + Intronic
932813802 2:74845476-74845498 TGGACAGGTGCTGCTGCCTAAGG + Intronic
933747748 2:85583314-85583336 TGAAGTGAAGCTTCTGCCTTGGG + Intergenic
934656954 2:96121369-96121391 TGGACAGGAGCAGGTGCCTTTGG - Intergenic
935275141 2:101469873-101469895 TGGAAAGAAAGGGCTGCCTTCGG + Intronic
936018180 2:108975234-108975256 GGGATAGCAGCTGCGGCCTCAGG + Intronic
937262389 2:120594966-120594988 TGAATAGAAGCTGCTCCCTTTGG + Intergenic
937357070 2:121204484-121204506 GGGACAGAAGCTCCTGCCCTTGG + Intergenic
939061698 2:137430535-137430557 TGGATAAAATCTCCTGCCTGAGG + Intronic
940376729 2:152966229-152966251 TGGATAATAGCTACAGCCTTTGG + Intergenic
940910378 2:159204986-159205008 TGGACAGAACCTGCTCCCTCTGG + Intronic
944381011 2:199110929-199110951 TGGATAGGGGCTCCTGGCTTAGG - Intergenic
1169705657 20:8501443-8501465 TGGATTGGACCCGCTGCCTTGGG - Intronic
1172039949 20:32036777-32036799 TGGATAGAAGGGGCTGCCATAGG - Intergenic
1173222779 20:41143076-41143098 TGGCTGGAAGCAGCTGCTTTGGG + Intronic
1173580127 20:44141277-44141299 TGGAGAGAAGCTGTTGCATTTGG + Intronic
1174880053 20:54269123-54269145 TGGGTAGATGCTGCAGCCTCAGG + Intergenic
1175386455 20:58598528-58598550 TGGCAAGAAGCTGCTGTCTCTGG + Intergenic
1175724305 20:61307102-61307124 GAGATAGCAGCTGCTGCCTTAGG + Intronic
1176663346 21:9660962-9660984 CGGATTGAAGCTGCTGGCTCAGG - Intergenic
1177729617 21:25011486-25011508 TGGAGAGAACCTGATGCATTTGG + Intergenic
1178063913 21:28882212-28882234 AGGGTACAAGCTGCTGCCTCAGG + Exonic
1179181093 21:39045844-39045866 TGACTGGGAGCTGCTGCCTTTGG - Intergenic
1180997043 22:19970851-19970873 TGGATAGAAGCATCTGCCCTGGG + Intronic
1181620646 22:24089003-24089025 GGGACTGAAGCTGCTGCCCTAGG + Intronic
1182768562 22:32776573-32776595 TGGCTCCAAGTTGCTGCCTTAGG + Intronic
1183188173 22:36304455-36304477 AGGTTAGCAGCTGCTACCTTTGG - Intronic
1183752995 22:39732746-39732768 TGAACAGAAGCTGCTCCTTTGGG + Intergenic
1184386612 22:44180168-44180190 GGGATAGGAGCTGTGGCCTTTGG - Intronic
1184833992 22:47009872-47009894 TGGACAGAAGAGGCTGCCTCAGG - Intronic
949390500 3:3557172-3557194 TGAAAATAAGCTGCTGCATTAGG - Intergenic
950120393 3:10478597-10478619 TGGAGAGAAGATGAGGCCTTTGG - Intronic
950406719 3:12809534-12809556 TGGATAGAAGCTGCTGAGGCAGG + Intronic
954694455 3:52413857-52413879 TGAAAAGAAGCTGATGTCTTAGG + Intronic
954799961 3:53181331-53181353 TGTAGGGAAGCTGCTCCCTTCGG + Intronic
955939260 3:64132429-64132451 TAGATAGAAACTGAGGCCTTAGG - Intronic
956699232 3:71944188-71944210 TGGGGAGAAACTGATGCCTTTGG - Intergenic
958784816 3:98586288-98586310 TTGGAATAAGCTGCTGCCTTCGG + Intronic
962763807 3:138542890-138542912 TGGATAGGAGCTGCCCACTTAGG - Intronic
963730897 3:148970976-148970998 TAGATAGAAGCGGATGCTTTGGG - Intergenic
964538880 3:157757016-157757038 TGGGGAGAACCTGCTGTCTTGGG + Intergenic
964872097 3:161324673-161324695 TGAATAGAAGCTGCTCATTTGGG + Intergenic
964927795 3:161978724-161978746 TGGATAGAAGCTACTGACCTAGG - Intergenic
966063919 3:175793613-175793635 TGGTTAGAAAATGCTGCTTTGGG - Intronic
967224196 3:187275276-187275298 TGGACAGAAGGGGCCGCCTTGGG + Intronic
967915910 3:194578089-194578111 TGGAAAGGAGCTGATGCCTTTGG - Intergenic
968255069 3:197262354-197262376 AGGATAGAAGCTCCTGCACTTGG + Intronic
968744163 4:2350866-2350888 GGGACAGAAGCTCCTGCCCTTGG + Intronic
968951977 4:3700058-3700080 AGGATAGAAGCTGCTGTGCTTGG + Intergenic
969062925 4:4453033-4453055 TGGATAGAAGCTGCTTATTATGG + Intronic
970539746 4:17065521-17065543 TGGGTAGAAGCTGTGGCCTCTGG + Intergenic
972886827 4:43502605-43502627 TAGTTAGCAGCTCCTGCCTTAGG - Intergenic
973735132 4:53864164-53864186 GGGATAGAAGGAGCTGCCTTGGG - Intronic
976519348 4:86008177-86008199 TGGATAGAAACTGCTCTCATTGG + Intergenic
979713089 4:123803699-123803721 TGGTTAGAAGCTGCTGCTATAGG + Intergenic
981952854 4:150431438-150431460 TGGCTAGTGGCTGCTGTCTTGGG - Intronic
984150589 4:176125286-176125308 TGTACAGAAGCTGCTGCACTGGG - Exonic
984463491 4:180067177-180067199 ATGATTGGAGCTGCTGCCTTGGG - Intergenic
984547414 4:181123427-181123449 TGTATAGAAGCTGCTGGTTTGGG - Intergenic
986850795 5:11811289-11811311 TGGTTAAATACTGCTGCCTTGGG + Intronic
987072496 5:14351536-14351558 TGAACAGAAGCTGTTGCCATTGG - Intronic
987611632 5:20211877-20211899 TGGTAAGAAGCTGGTTCCTTTGG - Intronic
991426328 5:66495872-66495894 TTGATACAAACTGCTGCCTTGGG - Intergenic
991522930 5:67520532-67520554 TGGAAGGCAGCTTCTGCCTTTGG - Intergenic
993161177 5:84293409-84293431 TGAATCCAAGCTGCTGCCTTTGG + Intronic
994201311 5:96979363-96979385 TGAATAGAAGCTCAGGCCTTCGG + Exonic
995469391 5:112484496-112484518 TTGATAGGAGCTGCTGTCTTTGG - Intergenic
997791539 5:136766679-136766701 TGGAAAGAAGCTGGTGCCCAGGG - Intergenic
999476989 5:151909323-151909345 TGGAGAAAAGATGGTGCCTTTGG - Intronic
999653833 5:153793753-153793775 TGGCCAGAAACTCCTGCCTTGGG + Intronic
1002755749 6:158164-158186 TGGATGGAGGCTGCTGCCGGAGG + Intergenic
1004080074 6:12383470-12383492 TGGATGGAAGCTGCAGCCACAGG - Intergenic
1004510612 6:16281356-16281378 TTCAGAGAAGTTGCTGCCTTGGG - Intronic
1004601013 6:17150036-17150058 GGGACAGAAGCTCCTGCCCTTGG - Intergenic
1004714586 6:18204910-18204932 CAGATCGTAGCTGCTGCCTTTGG + Intronic
1005016723 6:21381507-21381529 TGGACATAAGGTGTTGCCTTCGG + Intergenic
1006317103 6:33297646-33297668 GGGATTGGAGCTGCTACCTTCGG - Intronic
1010483523 6:76382326-76382348 GGGAGAGAAGCCTCTGCCTTTGG - Intergenic
1013162979 6:107563953-107563975 TGGATACTAGTTCCTGCCTTTGG - Intronic
1013415613 6:109921781-109921803 GCGATAGAAGCTTCTGCATTTGG - Intergenic
1014457459 6:121653005-121653027 TGGATTGAAGTTTTTGCCTTTGG + Intergenic
1014662319 6:124188343-124188365 TGGATAGAAGCTTCAGCCAGTGG - Intronic
1015542527 6:134329905-134329927 TGAATAGAAGCTGGTTACTTTGG + Intergenic
1016281051 6:142419273-142419295 TGGACAGAAGATGCTGGCTGCGG + Intronic
1016428632 6:143959797-143959819 TTAATAGAAGCTAATGCCTTTGG - Intronic
1016752723 6:147649143-147649165 TGGGTAGAAGCTGCTGCCTAGGG - Intronic
1021512330 7:21447662-21447684 TGGATTCTAGCTGCTGTCTTGGG + Intronic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1022557647 7:31315484-31315506 TGGATAAGAGCTGCTGACCTGGG + Intergenic
1023421085 7:39980614-39980636 TGGATAGCAGCTACTGTATTGGG + Intronic
1024555492 7:50599850-50599872 TGGATTGAAAGGGCTGCCTTGGG - Intronic
1025045483 7:55688841-55688863 GGGAAAGAAGCGGCTGCCCTGGG - Intergenic
1026793495 7:73350557-73350579 TGAAGAGAAGCTGAAGCCTTTGG + Intronic
1028233843 7:88336864-88336886 TGCATAGACACTGCTGCATTAGG - Intergenic
1029853521 7:103489634-103489656 TGGATAGAAACTCCAGCCTGAGG - Intronic
1030944191 7:115695674-115695696 TGTGTAGAACCTTCTGCCTTAGG + Intergenic
1031245180 7:119302563-119302585 TGGATCGCAGTTGCTACCTTTGG + Intergenic
1032578955 7:133085763-133085785 TGGCTAGTAAATGCTGCCTTTGG - Intergenic
1033780942 7:144668072-144668094 GGGACAGAAGCTCCTGCCTTAGG + Intronic
1034451348 7:151138781-151138803 GGGCGAGATGCTGCTGCCTTCGG - Intronic
1034756230 7:153622990-153623012 TGGACAGGATCTGCTTCCTTTGG + Intergenic
1037659525 8:20915022-20915044 TGGATAGAAAAGGCTGCTTTGGG - Intergenic
1038627746 8:29210496-29210518 TGGAAAGAAGATGCTTTCTTGGG - Intronic
1039833292 8:41235294-41235316 TGGATAGAAACCCCTGCCCTCGG + Intergenic
1041893171 8:62894598-62894620 CTGATAGCAGCTGCTGCCTCTGG - Intronic
1042515361 8:69653491-69653513 AGGACAGAAGCTTCTGCGTTTGG - Intronic
1042550538 8:69990550-69990572 TGAATGGAGGCTGCTGGCTTGGG - Intergenic
1043209477 8:77492862-77492884 TGAAGGGAAGCTTCTGCCTTGGG - Intergenic
1043738829 8:83781216-83781238 TGGATAGAATCTGTTGGGTTTGG - Intergenic
1044403746 8:91802239-91802261 TGGATATCAGATACTGCCTTCGG + Intergenic
1044629358 8:94263554-94263576 TCAATAGATGCTGGTGCCTTTGG - Intergenic
1046062203 8:109152991-109153013 TGGATAGATGCTGTTGGCTGGGG + Intergenic
1046722250 8:117633597-117633619 TGCATAGAAGCCGCTGTCTGTGG - Intergenic
1046778241 8:118186840-118186862 CGGAAGGAAGCAGCTGCCTTTGG + Intergenic
1048802773 8:138209355-138209377 TGGACAGATGCTGCTGCAGTTGG + Intronic
1049529522 8:143147426-143147448 TGGATAGGAGCTGCTGACACAGG + Intergenic
1052437170 9:28444047-28444069 TGGATAGAAGCTACCAACTTTGG + Intronic
1053565090 9:39241389-39241411 TGTATGGGGGCTGCTGCCTTAGG - Intronic
1054132060 9:61377649-61377671 TGTATGGGGGCTGCTGCCTTAGG + Intergenic
1054599692 9:67108210-67108232 TGCATGGGGGCTGCTGCCTTAGG + Intergenic
1056605550 9:88082069-88082091 GGGATGGAAGCTCCTGCCCTGGG + Intergenic
1057336809 9:94162066-94162088 TGGAGAGAACATGCAGCCTTTGG - Intergenic
1057484232 9:95469656-95469678 TGGACAGAGGCTGCTTCCCTAGG - Intronic
1059559315 9:115317000-115317022 TGGACTGAAGCTTCTGCTTTGGG + Intronic
1062688205 9:137827284-137827306 GGGCTAGATGCTGCTGCCTCGGG - Intronic
1203662752 Un_KI270753v1:60803-60825 CGGATTGAAGCTGCTGGCTCAGG + Intergenic
1189107842 X:38255817-38255839 TGTAAAGAAGATGCTGCCTCTGG + Intronic
1189239388 X:39514033-39514055 TCAACAGAATCTGCTGCCTTAGG - Intergenic
1189365855 X:40387850-40387872 TGTAAAGAAGATGCTGCCTCTGG + Intergenic
1191968245 X:66785039-66785061 TGGGTAAAAGGTGCTGCCTGGGG - Intergenic
1193108377 X:77703814-77703836 TGGAAAGGAGCTGCCCCCTTTGG - Intronic
1195212339 X:102661612-102661634 TGGATGGCAGCTTCTGCATTTGG - Intergenic
1195218380 X:102722361-102722383 TGGATGGCAGCTTCTGCATTTGG - Intronic
1195289611 X:103419652-103419674 TGGAAAGAGACTGCTACCTTGGG - Intergenic
1195289711 X:103420440-103420462 TGGAAAGAGACTGCTACCTTGGG - Intergenic
1195611435 X:106871904-106871926 TGGAGAGAAGCTCCTGCGCTTGG - Intronic
1197706817 X:129640083-129640105 GGGATAGAGGCTGGTGACTTTGG - Intergenic
1199287349 X:146068273-146068295 TGGATAGTAGTTGTTTCCTTTGG - Intergenic
1200108570 X:153727293-153727315 TGGCAAGCAGCTGCAGCCTTGGG + Intronic
1201569446 Y:15398528-15398550 AGCATAGAAGCAGCTGCTTTGGG - Intergenic