ID: 1065477408

View in Genome Browser
Species Human (GRCh38)
Location 10:26155169-26155191
Sequence TAGAGTAGACAGATAGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065477402_1065477408 -5 Left 1065477402 10:26155151-26155173 CCCCATCCTGAATGATTTTAGAG 0: 1
1: 0
2: 2
3: 24
4: 275
Right 1065477408 10:26155169-26155191 TAGAGTAGACAGATAGGGCAAGG No data
1065477404_1065477408 -7 Left 1065477404 10:26155153-26155175 CCATCCTGAATGATTTTAGAGTA 0: 1
1: 0
2: 1
3: 12
4: 215
Right 1065477408 10:26155169-26155191 TAGAGTAGACAGATAGGGCAAGG No data
1065477400_1065477408 7 Left 1065477400 10:26155139-26155161 CCAATTCTCCTTCCCCATCCTGA 0: 1
1: 1
2: 7
3: 68
4: 723
Right 1065477408 10:26155169-26155191 TAGAGTAGACAGATAGGGCAAGG No data
1065477401_1065477408 -1 Left 1065477401 10:26155147-26155169 CCTTCCCCATCCTGAATGATTTT 0: 1
1: 0
2: 5
3: 39
4: 507
Right 1065477408 10:26155169-26155191 TAGAGTAGACAGATAGGGCAAGG No data
1065477403_1065477408 -6 Left 1065477403 10:26155152-26155174 CCCATCCTGAATGATTTTAGAGT 0: 1
1: 0
2: 3
3: 27
4: 211
Right 1065477408 10:26155169-26155191 TAGAGTAGACAGATAGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065477408 Original CRISPR TAGAGTAGACAGATAGGGCA AGG Intronic
No off target data available for this crispr