ID: 1065477974

View in Genome Browser
Species Human (GRCh38)
Location 10:26161492-26161514
Sequence TACTGAAGGCAGTAGTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065477970_1065477974 24 Left 1065477970 10:26161445-26161467 CCTGTACATAATGGTTTGGCTAC 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1065477974 10:26161492-26161514 TACTGAAGGCAGTAGTATGGTGG No data
1065477971_1065477974 2 Left 1065477971 10:26161467-26161489 CCAGAGCTCTAATACAACTAGAA 0: 1
1: 0
2: 0
3: 8
4: 262
Right 1065477974 10:26161492-26161514 TACTGAAGGCAGTAGTATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065477974 Original CRISPR TACTGAAGGCAGTAGTATGG TGG Intronic
No off target data available for this crispr