ID: 1065480898

View in Genome Browser
Species Human (GRCh38)
Location 10:26192990-26193012
Sequence TCTAGGACTTTGAGAGCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 7, 3: 55, 4: 445}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065480898_1065480909 28 Left 1065480898 10:26192990-26193012 CCCTTAGCTCTCAAAGTCCTAGA 0: 1
1: 0
2: 7
3: 55
4: 445
Right 1065480909 10:26193041-26193063 GTGAGGAGTAGGATAAGGGTTGG 0: 1
1: 2
2: 1
3: 18
4: 300
1065480898_1065480901 -5 Left 1065480898 10:26192990-26193012 CCCTTAGCTCTCAAAGTCCTAGA 0: 1
1: 0
2: 7
3: 55
4: 445
Right 1065480901 10:26193008-26193030 CTAGACCACCAGACAACTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 44
1065480898_1065480904 6 Left 1065480898 10:26192990-26193012 CCCTTAGCTCTCAAAGTCCTAGA 0: 1
1: 0
2: 7
3: 55
4: 445
Right 1065480904 10:26193019-26193041 GACAACTAGAGGAAAGCACATGG 0: 1
1: 0
2: 1
3: 22
4: 348
1065480898_1065480906 17 Left 1065480898 10:26192990-26193012 CCCTTAGCTCTCAAAGTCCTAGA 0: 1
1: 0
2: 7
3: 55
4: 445
Right 1065480906 10:26193030-26193052 GAAAGCACATGGTGAGGAGTAGG 0: 1
1: 0
2: 2
3: 23
4: 313
1065480898_1065480905 11 Left 1065480898 10:26192990-26193012 CCCTTAGCTCTCAAAGTCCTAGA 0: 1
1: 0
2: 7
3: 55
4: 445
Right 1065480905 10:26193024-26193046 CTAGAGGAAAGCACATGGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 209
1065480898_1065480907 23 Left 1065480898 10:26192990-26193012 CCCTTAGCTCTCAAAGTCCTAGA 0: 1
1: 0
2: 7
3: 55
4: 445
Right 1065480907 10:26193036-26193058 ACATGGTGAGGAGTAGGATAAGG 0: 1
1: 0
2: 1
3: 31
4: 222
1065480898_1065480908 24 Left 1065480898 10:26192990-26193012 CCCTTAGCTCTCAAAGTCCTAGA 0: 1
1: 0
2: 7
3: 55
4: 445
Right 1065480908 10:26193037-26193059 CATGGTGAGGAGTAGGATAAGGG 0: 1
1: 0
2: 1
3: 19
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065480898 Original CRISPR TCTAGGACTTTGAGAGCTAA GGG (reversed) Intronic
901373949 1:8824116-8824138 CCCAGCACTTTGAGAGCCAAAGG + Intergenic
902027370 1:13394173-13394195 TCTAGGAGTTTGAGATCAACTGG - Intergenic
902692975 1:18121794-18121816 ACTTGGACATTGAGAGCCAATGG - Intronic
902972754 1:20066754-20066776 TCTAGGACTTTGGGAGGCAGAGG + Intronic
903370273 1:22830803-22830825 TCTAGGACTTTGGGAGGCCAAGG - Intronic
903922740 1:26812564-26812586 TCCAGCACTTTGAGAGGCAAAGG - Intergenic
904020168 1:27457871-27457893 CCTAGCACTTTGGGAGGTAAAGG - Intronic
904159617 1:28513443-28513465 TCTAGCACTTTGGGAGGTCAGGG - Intronic
904638907 1:31906968-31906990 TCTAGGACTTTAAAACATAATGG - Exonic
904812790 1:33174432-33174454 TCCAGTACTTTGAGAGGTCAAGG - Intronic
905987167 1:42296409-42296431 TCTAGGACTTTTATAGTTTAAGG + Intronic
906384543 1:45356381-45356403 CCTAGAACTTTGAGAGGTAGAGG + Intronic
907200411 1:52721798-52721820 TCCAGCACTTTGAGAGGTCAAGG - Intergenic
907207114 1:52782869-52782891 TACAGGACTTTGGGAGCTCAAGG - Intronic
908790424 1:67775649-67775671 CTTAGCTCTTTGAGAGCTAAAGG - Intronic
911225832 1:95304761-95304783 CCTTGGACTTCGAGAGGTAATGG + Intergenic
911274461 1:95844169-95844191 TCCAGGACTTTGAGAGGTCAAGG - Intergenic
912455547 1:109794429-109794451 AACAGGACTTTGAGGGCTAACGG + Intergenic
913012796 1:114701217-114701239 TCTAGCACTTTGAGAGGCCAAGG - Intergenic
913314010 1:117534893-117534915 TCAAGGCCTTTAAGAGCTACAGG - Intergenic
913568964 1:120101407-120101429 TCTAGGTGTTTGGGATCTAAGGG + Intergenic
914289773 1:146262398-146262420 TCTAGGTGTTTGGGATCTAAGGG + Intergenic
914550817 1:148713181-148713203 TCTAGGTGTTTGGGATCTAAGGG + Intergenic
914738573 1:150442979-150443001 TCTAGGACTTTATGACCTGAAGG + Intronic
915295711 1:154920100-154920122 CCCAGCACTTTGAGAGCTCAAGG - Intergenic
915628649 1:157134889-157134911 TCTAGCCCCTTGAGGGCTAAAGG + Intronic
916398911 1:164424063-164424085 CTTAGGCCTTTGAGAGCCAATGG - Intergenic
916631131 1:166613599-166613621 TATAGGACTTTTAGAACTGAAGG - Intergenic
917033297 1:170718962-170718984 TCTAGGACCCTGAGATCTTAGGG - Intronic
917413671 1:174785623-174785645 TCTGGTATTTGGAGAGCTAAAGG + Intronic
918956545 1:191216255-191216277 TCTAGGATTCTGTGAGTTAAAGG + Intergenic
919098741 1:193067760-193067782 TCTAGGAGTTTTAGAGCTAATGG + Intronic
920159104 1:203982267-203982289 TCTAGCACTTTGGGAGGTCAGGG + Intergenic
920655982 1:207875441-207875463 CCTAGCACTTTGAGAGGTCAAGG - Intergenic
920692791 1:208159580-208159602 TTTAGGACTCTGACAGCCAAGGG + Intronic
921026512 1:211287957-211287979 CCTAGCACTTTGAGAGCCCAAGG + Intronic
921228347 1:213043306-213043328 TCCAGCACTTTGAGAGGCAAAGG + Intergenic
922148065 1:222968681-222968703 CCTAGCACTTTGAGAGCCAGAGG + Intronic
923838138 1:237637757-237637779 TTTATGACTTTGATAGATAAGGG + Intronic
924190600 1:241548178-241548200 TCTAGCACTTTGAGAGGCCAAGG + Intronic
1064095727 10:12423261-12423283 TCCAGCACTTTGAGAGGTCAAGG + Intronic
1064267821 10:13839254-13839276 TCTAGAACTTTGAGAGGCCAAGG - Intronic
1065480898 10:26192990-26193012 TCTAGGACTTTGAGAGCTAAGGG - Intronic
1066577434 10:36842143-36842165 CCTAGCACTTTGAGAGCCCAAGG + Intergenic
1067002878 10:42634152-42634174 CCTAGTACTTTGGGAGGTAAAGG + Intronic
1067135433 10:43603378-43603400 TCCAGGAATTGGAAAGCTAAGGG - Intergenic
1068019927 10:51568488-51568510 TCCAGCACTTTGAGAGGTCAAGG - Intronic
1069106325 10:64387129-64387151 TCAAGCACTTTGGGAGCCAAGGG - Intergenic
1069666393 10:70163380-70163402 TCTAGGACTTTCATAGCTAGAGG + Intronic
1070837910 10:79462613-79462635 TTTAGGACTTAGAGAGATAAGGG + Intergenic
1070842608 10:79497748-79497770 CCTAGCACTTTGAGAGGCAAAGG + Intergenic
1072167471 10:92827945-92827967 ACTAGGATTTGGGGAGCTAATGG - Intergenic
1072363590 10:94685282-94685304 TCCAGCACTTTGAGAGACAAAGG - Intronic
1074751091 10:116587953-116587975 TCAAGGACTTTGAGAACTCTAGG + Intergenic
1075008041 10:118844331-118844353 TCTGGGAATCAGAGAGCTAAGGG - Intergenic
1075052471 10:119193012-119193034 ACTTGGACTTTGAGAGATAATGG - Intergenic
1075176713 10:120170839-120170861 TCTAAGACTTTGATAGATTAAGG - Intergenic
1075348891 10:121706018-121706040 TCCAGCACTTTGAGAGGTCAAGG - Intergenic
1076567502 10:131408934-131408956 TCTAGCACTTTGGGAGGTCAAGG - Intergenic
1077400285 11:2352257-2352279 TCTAGGGCTTTGAGGGCAGAAGG - Intergenic
1079503176 11:21125345-21125367 TCTTGGACTTTGAAAGATTAAGG + Intronic
1079724132 11:23858820-23858842 TCTAGGACTTGTAGAGCTTGAGG - Intergenic
1079729766 11:23925377-23925399 TCAAGGACTTTGAGAACAGAGGG - Intergenic
1079770878 11:24458040-24458062 TATAGGATTTTGAAAACTAATGG + Intergenic
1080048309 11:27832980-27833002 TCTAGGACTTTGGGAGGTCAAGG + Intergenic
1080215965 11:29840971-29840993 CCTAGGATTTTTAGAGCTAGAGG + Intergenic
1080741475 11:35068551-35068573 TCTAGCACTTTGGGAGGTTAAGG + Intergenic
1080826681 11:35854562-35854584 TCTTGGATTTTGATATCTAAGGG + Intergenic
1081031624 11:38091056-38091078 TCTAGCACTTTGAGAGACAGAGG - Intergenic
1081273322 11:41115189-41115211 ACTAAAACTTTCAGAGCTAAAGG + Intronic
1083284447 11:61649226-61649248 TCTAGCACTTTGGGAGGTCAAGG - Intergenic
1083425249 11:62581015-62581037 ACTAAGACATGGAGAGCTAAAGG + Intronic
1085443823 11:76587330-76587352 TCCAGGAATTTGAGAGTTCAAGG - Intergenic
1087378580 11:97375845-97375867 ACTAAGACTATGTGAGCTAAGGG + Intergenic
1087718091 11:101632322-101632344 TCAAGGACTATGAGGGCTGAGGG - Intronic
1087745204 11:101936580-101936602 TCTAGGACTTCCAGTGCAAATGG + Intronic
1088029950 11:105236378-105236400 TCTAGGACTTTTATAGTTTAAGG - Intergenic
1089229562 11:116960273-116960295 TCCAGCACTTTGGGAGTTAAAGG + Intronic
1090543856 11:127739775-127739797 TCCAGCACTTTGGGAGGTAAAGG + Intergenic
1090773500 11:129943607-129943629 CCTAGCACTTTGAGAGCCCAAGG + Intronic
1091164228 11:133457280-133457302 TCTAGCACTTTGGGAGCCCAAGG + Intronic
1092302171 12:7262021-7262043 TCTAGCACTTTGGGAGGTCATGG + Intergenic
1092473353 12:8797491-8797513 CCTAGCACTTTGAGAGCCCAAGG + Intergenic
1093407095 12:18817841-18817863 TCTAGCACTTTGGGAGCTTGAGG + Intergenic
1093427601 12:19046051-19046073 TCTAGGACTTTCATAGATAGAGG + Intergenic
1094324289 12:29220006-29220028 TCAAGGAATTTTAGAGCTAGTGG + Intronic
1095193037 12:39280199-39280221 CCTAGCACTTTGAGAGTCAAAGG + Intergenic
1095430275 12:42126502-42126524 TCCAGCACTTTGAGAGGCAATGG + Intronic
1095839058 12:46671959-46671981 TCAAAAACTATGAGAGCTAAGGG - Intergenic
1095872204 12:47041607-47041629 TCTAGTACTTTGAGAGGCAGAGG + Intergenic
1096138529 12:49223128-49223150 TCTAGCACTTTGGGAGGTCAAGG + Intronic
1096725196 12:53555758-53555780 TCTAGCACTTTGGGAGGTCAAGG - Intronic
1096751656 12:53763022-53763044 CCTAGCACTTTGAGAGGTCAAGG - Intergenic
1097729149 12:63107807-63107829 TCTAAGACTATAAGAGCAAATGG - Intergenic
1098025886 12:66201065-66201087 TCTAGCACTTTGAGAGGCCAAGG - Intronic
1098712680 12:73785161-73785183 CCTAGCACTTTGAGAGGTCAAGG + Intergenic
1099227287 12:79984381-79984403 GACAGGACTTTGAGAGCTCAGGG + Intergenic
1099498482 12:83381443-83381465 TCTAGGACTTTGGGAGGCCAAGG - Intergenic
1099968490 12:89476155-89476177 TCTAGCACTTTGGGAGGTGAAGG - Intronic
1102131111 12:110529498-110529520 TCTAGCACTTTGGGAGGTGAAGG + Intronic
1102626506 12:114239594-114239616 ACTACCACTTTGAGACCTAAGGG - Intergenic
1103511181 12:121475641-121475663 CCTAGGACTTTGAGAGGCTAAGG + Intronic
1104411743 12:128563994-128564016 TCCAGAACTTTGAGAAATAAAGG - Intronic
1105052642 12:133068311-133068333 TCTAGCACTTTGGGAGGTCAAGG + Intergenic
1105395585 13:20030782-20030804 TCTAGCACTTTGGGAGGTCAAGG - Intronic
1107087716 13:36443999-36444021 TCCAGCACTTTGAGAGGTCAAGG - Intergenic
1107564823 13:41591199-41591221 TCTGGGACTTAGAGTGCAAATGG + Intronic
1108105182 13:47001178-47001200 TGTAGGTCTTTGAGTGCTCATGG + Intergenic
1108682450 13:52791339-52791361 CCTAGCACTTTGAGAGGTCAAGG + Intergenic
1111482973 13:88856254-88856276 TCTAGCACTTTGAGAGGCCAAGG - Intergenic
1112071979 13:95863111-95863133 CCTAGCACTTTGAGAGGTGATGG - Intronic
1112139440 13:96621915-96621937 TATAGGATTTTGAGGGATAATGG + Intronic
1112287835 13:98119483-98119505 TCTAGCACTTTGAGAGGCCAAGG + Intergenic
1112517881 13:100071227-100071249 GCCAGGATTTTGAGAGTTAATGG + Intergenic
1112653382 13:101422350-101422372 TCTAGGACTTTTATAGCTAGAGG - Intergenic
1114294216 14:21314769-21314791 TCTAGCACTTTGAGAGGCCAAGG + Intronic
1116141723 14:41004617-41004639 TCTAAGACTTTCATAGCTAGAGG + Intergenic
1116855119 14:49945455-49945477 TCTAGGACTTTGGAAGCTGTGGG + Intergenic
1117005854 14:51420159-51420181 TCAGGGACTCTGAGAGATAAAGG - Intergenic
1117131141 14:52687933-52687955 TCCAGCACTTTGAGAGGTGAAGG + Intronic
1117579700 14:57139764-57139786 TCCAGCACTTTGAGAGGTCAAGG - Intergenic
1118878130 14:69802201-69802223 CCTAGGAGTTTGAGAGGTCAGGG + Intergenic
1119658518 14:76434399-76434421 CCTAGCACTTTGGGAGGTAAAGG + Intronic
1120594652 14:86418739-86418761 TCTAAAACTTTGAAAGTTAAAGG + Intergenic
1120788473 14:88558057-88558079 TCCAGCACTTTGAGAGGTCAAGG + Intergenic
1122057158 14:99108227-99108249 TCCAGGACTTTGAGAGGCAGAGG - Intergenic
1122648715 14:103212974-103212996 TATAGGAGTTTGGGAGTTAAGGG - Intergenic
1123667405 15:22618522-22618544 TCCAGGACTTTGAGAGCCCAAGG + Intergenic
1124321248 15:28713087-28713109 TCCAGGACTTTGAGAGCCCAAGG + Intronic
1124481248 15:30082265-30082287 TCCAGGACTTTGAGAGCCCAAGG - Intergenic
1124487703 15:30134361-30134383 TCCAGGACTTTGAGAGCCCAAGG - Intergenic
1124522349 15:30414927-30414949 TCCAGGACTTTGAGAGCCCAAGG + Intergenic
1124536315 15:30551291-30551313 TCCAGGACTTTGACAGCCCAAGG - Intergenic
1124542794 15:30603338-30603360 TCCAGGACTTTGAGAGCCCCAGG - Intergenic
1124702233 15:31926007-31926029 CCTTGGAGTTTGGGAGCTAATGG + Intergenic
1124755826 15:32403960-32403982 TCCAGGACTTTGAGAGCCCAAGG + Intergenic
1124762336 15:32456301-32456323 TCCAGGACTTTGAGAGCCCAAGG + Intergenic
1124776295 15:32592769-32592791 TCCAGGACTTTGAGAGCCCAAGG - Intergenic
1125871956 15:43110140-43110162 TCTAGCACTTTGGGAGGCAAAGG - Intronic
1125898116 15:43319701-43319723 TCTAGCACTTTGGGAGCACAAGG - Intergenic
1126536665 15:49773910-49773932 TCCAGCACTTTGAGAGGTCAAGG - Intergenic
1126971939 15:54125211-54125233 TCTAGCACTTTGAGAGGCCATGG + Intronic
1127167434 15:56261465-56261487 CCTAGCACTTTGAGAGGTCAAGG + Intronic
1128658713 15:69482334-69482356 TCTAGCACTTTGGGAGGTCAAGG - Intergenic
1129000973 15:72333582-72333604 TCCAGGAGTTTGAGAGCAACTGG - Intronic
1130189528 15:81720127-81720149 TCTAGCACTTTGGGAGGTCAAGG + Intergenic
1130265517 15:82398531-82398553 TCCAGCACTTTGAGAGATCAAGG - Intergenic
1130804891 15:87309557-87309579 TCTAGCACTTTGAGAGGCCAAGG - Intergenic
1131862561 15:96669848-96669870 TCCAGGACTTTGAGAGGTTGAGG + Intergenic
1132297839 15:100755345-100755367 TCTAGGCCTTTGTGAACAAATGG + Intergenic
1132535812 16:479670-479692 TCTAGCACTTTGAGAGGCCAAGG + Intronic
1133483523 16:6195465-6195487 TCCAGGACTTTGAGAGGCCAAGG + Intronic
1134166600 16:11934997-11935019 TCTAGAACTCAGAGAGCTGAAGG - Intronic
1134210215 16:12270109-12270131 TCTAGGACTTTGGGAGGCCAAGG - Intronic
1134494106 16:14718707-14718729 TCTAGAACTCAGAGAGCTGAAGG + Intronic
1134499486 16:14757831-14757853 TCTAGAACTCAGAGAGCTGAAGG + Intronic
1134526036 16:14944459-14944481 TCTAGAACTCAGAGAGCTGAAGG + Intronic
1134546371 16:15111905-15111927 TCTAGAACTCAGAGAGCTGAAGG - Intronic
1134581086 16:15371188-15371210 TCTAGAACTCAGAGAGCTGAAGG - Intronic
1134713616 16:16342946-16342968 TCTAGAACTCAGAGAGCTGAAGG + Intergenic
1134721486 16:16386304-16386326 TCTAGAACTCAGAGAGCTGAAGG + Intronic
1134945940 16:18325580-18325602 TCTAGAACTCAGAGAGCTGAAGG - Intronic
1134953203 16:18365724-18365746 TCTAGAACTCAGAGAGCTGAAGG - Intergenic
1135311991 16:21412411-21412433 TCTAGAACTCAGAGAGCTGAAGG - Intronic
1135344845 16:21680261-21680283 TCCAGGACTTTGAGAGGCCAAGG + Intronic
1135364940 16:21844867-21844889 TCTAGAACTCAGAGAGCTGAAGG - Intronic
1135446900 16:22526472-22526494 TCTAGAACTCAGAGAGCTGAAGG + Intronic
1135568761 16:23532061-23532083 TCTAGCACTTTGAGAGGCCAAGG - Intronic
1135625444 16:23990796-23990818 TCTAGCACTTTGGGAGGTCAAGG - Intronic
1135642620 16:24134146-24134168 CCTAGCACTTTGAGAGGTCAAGG - Intronic
1136151158 16:28350336-28350358 TCTAGAACTCAGAGAGCTGAAGG - Intronic
1136167392 16:28464175-28464197 TCTAGAACTCAGAGAGCTGAAGG - Intronic
1136195585 16:28650842-28650864 TCTAGAACTCAGAGAGCTGAAGG + Intronic
1136211923 16:28764958-28764980 TCTAGAACTCAGAGAGCTGAAGG + Intronic
1136256643 16:29044903-29044925 TCTAGAACTCAGAGAGCTGAAGG + Intronic
1136308693 16:29391404-29391426 TCTAGAACTCAGAGAGCTGAAGG - Intronic
1136322111 16:29492934-29492956 TCTAGAACTCAGAGAGCTGAAGG - Intronic
1136436790 16:30232906-30232928 TCTAGAACTCAGAGAGCTGAAGG - Intronic
1137343511 16:47633760-47633782 TCGAGGACTTTTACAGCTCAGGG - Intronic
1137364121 16:47845928-47845950 TCTGTGCCTTTGAGAGCTTACGG - Intergenic
1138091063 16:54174973-54174995 TCTAGCACTGAGGGAGCTAATGG + Intergenic
1138310982 16:56023758-56023780 TCTAGTAGTTTGTGATCTAATGG - Intergenic
1139018894 16:62724349-62724371 CCCAGCACTTTGAGAGCCAAGGG + Intergenic
1139401731 16:66687413-66687435 CCTTGGACTTTGGGAGCTGAAGG + Intronic
1139856398 16:69983834-69983856 TCTAGAACTCAGAGAGCTGAAGG - Intergenic
1140334930 16:74096118-74096140 TCTAGCACTTTGAGAGGTTGAGG - Intergenic
1140366334 16:74384228-74384250 TCTAGAACTCAGAGAGCTGAAGG + Intronic
1140878809 16:79178565-79178587 TCTAGCACTTTGAGAGGTCGAGG - Intronic
1141065067 16:80907718-80907740 GCTAGGACTTTGAGAACTCCTGG - Intergenic
1141143317 16:81511810-81511832 CCTAGCACTTTGAGAGGTAGAGG - Intronic
1141982949 16:87561123-87561145 GCCAGGCCTTTGGGAGCTAAGGG + Intergenic
1142727347 17:1825751-1825773 CCTAGCACTTTGGGAGCCAAAGG - Intronic
1142953093 17:3500356-3500378 TCTAGGACTTTCCTAGCTAGAGG + Exonic
1142960114 17:3547368-3547390 CCCAGCACTTTGAGAGCTAGAGG + Intronic
1143222177 17:5271792-5271814 TCCAGGACTTTGTGAGGTCAAGG - Intergenic
1144023248 17:11255592-11255614 ACTTGGACTTTGACAGCCAAAGG - Intronic
1144324524 17:14166199-14166221 TCTAGGACTTTGATAGCTAGAGG + Intronic
1145886579 17:28386041-28386063 TCTAGGACTTTGGGAGGCCAAGG + Intronic
1145966521 17:28922342-28922364 CCTAGTACTTTGAGAGATCAAGG - Intronic
1147435033 17:40406149-40406171 TCTAGGACTTTGGGAGGCCAAGG - Intronic
1147696418 17:42358160-42358182 TCTAGCACTTTGAGAGGCCAAGG + Intronic
1150330350 17:64289252-64289274 CCTAGGACTATGAGAGTTAGAGG + Intergenic
1150333699 17:64314687-64314709 TCTAGCACTTTGAGAGGCCAAGG - Intergenic
1150650518 17:67006922-67006944 TCCAGGACTTTGGGAGGTCAAGG + Intronic
1150665401 17:67131136-67131158 CCTAGCACTTTGAGAGGTCAAGG - Intronic
1150751119 17:67863532-67863554 TCTAGAACTTTGAGAGGCCAAGG - Intronic
1151949288 17:77340676-77340698 TCTAGGATTTTCATAGCTAGAGG - Intronic
1153352881 18:4100622-4100644 TCTAGGCCTTTCAGAGCTAAAGG - Intronic
1154117871 18:11627097-11627119 TCTAGAACTCAGAGAGCTGAAGG - Intergenic
1155572539 18:27211369-27211391 TCTAGCATTTTGAGAGATAAAGG + Intergenic
1156635021 18:39017137-39017159 TCTAGGAGTTTCATAGCTACAGG - Intergenic
1157965889 18:52207666-52207688 TCTTTGACTTTGAGAGATTATGG + Intergenic
1158046009 18:53156232-53156254 TCCAGGACTTTGAGAGGCCAAGG + Intronic
1158698366 18:59723312-59723334 TCTAGCACTTTGAGAGGCCAAGG + Intergenic
1158698579 18:59725802-59725824 TCTAGGACTTTGGTTGCTTATGG + Intergenic
1158724353 18:59955744-59955766 CCTAGCACTTTGAGAGGTGAAGG - Intergenic
1159388875 18:67762129-67762151 TCTAGGACTTTCATAGCTGAGGG + Intergenic
1162637691 19:11983276-11983298 TCTAGCACTTTGAGAGGCCAAGG + Intergenic
1163468018 19:17480626-17480648 GCTAGGACTTTGAAAGGTCAAGG - Intronic
1163601623 19:18252512-18252534 TCCAGCACTTTGAGAGGTCAAGG + Intronic
1163706784 19:18819073-18819095 TCTAGTGCTTTGAGAGGCAAAGG - Intergenic
1163762028 19:19142469-19142491 TCTAGGACTGTGTGCGCTAAGGG + Intergenic
1164069820 19:21757185-21757207 TCTAGCACTTTGGGAGCCCAAGG + Intronic
1164915497 19:32048624-32048646 TCGGGGAGTTTGAGAGCAAAGGG - Intergenic
1165891167 19:39113179-39113201 TCTAGCACTTTGAGAGACCAAGG - Intergenic
1166310662 19:41960598-41960620 TCCAGGAGTTTGAGACCTACTGG - Intergenic
1166791836 19:45403390-45403412 TTTAGGACTCTGAGAGGCAAGGG - Intronic
1166796825 19:45431331-45431353 TCCAGGACTTTGGGAGGTCAAGG + Intronic
1167050130 19:47072814-47072836 ACAAGGACCTTGAGATCTAAAGG + Intronic
1167965175 19:53138365-53138387 CCTAGCACTTTGAGAGCCCAAGG - Intronic
927077643 2:19595984-19596006 TCTAGGATTCTAAGAGCCAATGG - Intergenic
927209538 2:20630517-20630539 CCCAGGACTTTGAGAGGTCAAGG - Intronic
927260296 2:21081511-21081533 TCTTGAACTTTAAGACCTAATGG + Intergenic
927306223 2:21576529-21576551 TCTAGCACTTTGGGAGGTTAAGG - Intergenic
927757554 2:25721340-25721362 TCTAAGACTTTAAGAGTAAAAGG - Intergenic
927974859 2:27330577-27330599 CCTAGCACTTTGGGAGGTAAAGG + Intronic
928068435 2:28190434-28190456 TCTAGCACTTTGGGAGCCCAAGG + Intronic
928554202 2:32406139-32406161 CCCAGGACTTTGAGAGGTAGAGG + Intronic
928917301 2:36485876-36485898 TCCAGGACGTTTAGAGTTAAAGG - Intronic
928925565 2:36575437-36575459 TCTAGGACTTTGAGAGGCTGAGG - Intronic
930507213 2:52298510-52298532 TCTAGGAATTTTATAGCTAGAGG + Intergenic
931281090 2:60792642-60792664 CCTAGCACTTTGAGAGGTCACGG + Intronic
931498068 2:62833427-62833449 TCTAGGAATTTCACAGCTAGAGG + Intronic
933591573 2:84238910-84238932 TATAAAACTTTTAGAGCTAATGG - Intergenic
933665441 2:84960919-84960941 CCTAGCACTTTGAGAGCCCAAGG - Intergenic
934096969 2:88615599-88615621 TCTAGAACTATGAGAAATAAAGG + Intronic
934501670 2:94865278-94865300 TCTATGACTTGGAAAACTAAAGG - Intergenic
936456285 2:112677016-112677038 TCTAGCACTTTGAGAGGCCAAGG + Intergenic
936973378 2:118195786-118195808 TCTAGAACTTTGAGAGGCCAAGG - Intergenic
938388430 2:130884578-130884600 TTTAATACTTTGAGGGCTAAAGG + Intronic
939486519 2:142819245-142819267 TCTAAGACTTTCATAGCTAAAGG - Intergenic
940936813 2:159504851-159504873 TGTAGAACTTTGATAGCTAAAGG - Intronic
941851183 2:170183003-170183025 TCTAGGACTTTGGGAGGCCAAGG + Intronic
942188536 2:173447843-173447865 CCTAGGACTTTGAGAGGCCAAGG + Intergenic
943070113 2:183131195-183131217 TCTAGCGCTTTGAGAGGTCAAGG - Intronic
943292875 2:186097677-186097699 TCTAGGACTTTCATAGCTAGAGG + Intergenic
944138247 2:196424930-196424952 TCTAGGACTTCCATAGCTAGAGG + Intronic
944338548 2:198567001-198567023 TCTAGGACTTTCATAGCTAGAGG + Intronic
944446813 2:199800178-199800200 TCTAGGAACTGGAGAGCAAAGGG + Intronic
945189378 2:207170513-207170535 TCTAGGACTTTCATAGCTAGAGG + Intergenic
945317910 2:208390964-208390986 TCAAAGCCTTGGAGAGCTAAGGG - Intronic
946067056 2:216996908-216996930 TCTAGGACTTTGGGAGGAGAGGG - Intergenic
946820203 2:223621174-223621196 TCTAGCACTTTGGGAGGTCAAGG - Intergenic
947983677 2:234430600-234430622 TCTAGCACTTTGAGAGGTTGGGG + Intergenic
948097609 2:235348981-235349003 TCAAGGCCTTTGAGTGCTTATGG - Intergenic
948400035 2:237677539-237677561 CCTAGCACTTTGAGAGGTCAAGG + Intronic
1169154316 20:3316526-3316548 TCTAAGATTATGAGAGTTAACGG + Intronic
1169715251 20:8609007-8609029 CCTAGGGCTTTCGGAGCTAAGGG + Intronic
1169776923 20:9265230-9265252 TCCAGCACTTTGGGAGCTCAAGG + Intronic
1170280537 20:14641974-14641996 TCTAGGACTTTCATAGGTAGAGG - Intronic
1171428626 20:25064544-25064566 TCTTGGAATTTTAGAGCTCAAGG - Intergenic
1171470612 20:25368181-25368203 TCTAGGATACTGAGAGCAAATGG + Intronic
1172758273 20:37303159-37303181 TCCAGCACTTTGGGAGCTCAAGG - Intronic
1174520630 20:51127731-51127753 TCAAGGACTTTGAGAACTTAGGG + Intergenic
1177171939 21:17664843-17664865 CCTAGCACTTTGGGAGCTTAAGG + Intergenic
1177869274 21:26550928-26550950 TCTAGGACTTTCATAGCTACAGG + Intronic
1178250878 21:31002121-31002143 TCTTAGAAGTTGAGAGCTAAAGG + Intergenic
1178324934 21:31637498-31637520 TCCAGCACTTTGAGAGGTCAGGG - Intergenic
1178950828 21:36984087-36984109 TCTAGGGCTTTGTGAGGCAAAGG - Intronic
1179006731 21:37521879-37521901 TTGAGGACTTTGAGTGCTAAGGG + Intergenic
1179202835 21:39242622-39242644 TCTAAGACTTTCACAGCTAGAGG + Intronic
1179307132 21:40164952-40164974 TCTAAGCCTTTGAAAGGTAAGGG - Intronic
1180537831 22:16411000-16411022 TCCAGCACTTTGAGAGGTCAAGG + Intergenic
1180623860 22:17180884-17180906 TCCAGCACTTTGGGAGCCAAGGG + Exonic
1181773721 22:25144984-25145006 TCAAGGACTCTGAGAGCAAAAGG - Intronic
1182213657 22:28698138-28698160 CCTAGCACTTTGGGAGCTCAAGG + Intronic
1182293867 22:29301770-29301792 CCTAGCACTTTGAGAGGTCAAGG - Intergenic
1182607319 22:31516260-31516282 TCTAGCACTTTGAGAGGCCAAGG + Intronic
1183439360 22:37814722-37814744 CCCAGGACTTTGGGAGCTTACGG - Intronic
1183497983 22:38161225-38161247 TCTAGAACTGTGAGAAATAAAGG - Intronic
1183963547 22:41427512-41427534 CCTAGAACTTTGAGAGGCAAAGG - Intergenic
1184126034 22:42487983-42488005 CCTAGCACTTTGAGAGCCCAAGG + Intergenic
949304576 3:2625436-2625458 TCTGGAAATTTCAGAGCTAATGG - Intronic
950060186 3:10064578-10064600 TTTAGGAATTTTGGAGCTAAGGG - Intronic
950067231 3:10122453-10122475 CCTAGGACTTTGAGAGGCCAAGG + Intronic
950301553 3:11883801-11883823 TTTAGGAATTTTGGAGCTAAGGG - Intergenic
951214523 3:20011231-20011253 TCAAGGCCTTTGAGAGCTTTTGG + Intronic
951814730 3:26741488-26741510 CCTAGCACTTTGAGAGGCAAAGG - Intergenic
951905427 3:27701821-27701843 TCCAGCACTTTGAGAGGTCAAGG - Intergenic
952440766 3:33326122-33326144 TCTCAGAGTGTGAGAGCTAAGGG - Intronic
952627924 3:35429082-35429104 TCTAGCACTTTGAGAGGCCACGG - Intergenic
952642083 3:35609567-35609589 TGCAGAACTTTGAGAGCCAAAGG - Intergenic
954545872 3:51434149-51434171 TCTAGTACTTTGAGAGGCCAAGG + Intronic
955401946 3:58598429-58598451 TCTGGGTCTCTGAGACCTAAGGG - Intronic
955472302 3:59298286-59298308 ACTAGGCCTTGGAGAGGTAATGG + Intergenic
957690679 3:83562692-83562714 TCTAGGACTTCGAGAGTTCGAGG - Intergenic
957801873 3:85095276-85095298 TCTAGGAGATTGAGAGAAAATGG + Intronic
958608025 3:96385349-96385371 CCCAGGACTTTGGGAGGTAAAGG - Intergenic
958800119 3:98745282-98745304 CCTAGGACTTTGGGAGGTCAAGG - Intronic
960160636 3:114346934-114346956 CCCAGGACTTTGGGAGGTAAAGG - Intronic
960399545 3:117179581-117179603 TCTAGGAGTTAGAGGGCTCAGGG + Intergenic
960476442 3:118135306-118135328 TCTAGGACTTTCATAGTTAGAGG + Intergenic
960711196 3:120530363-120530385 TCTAGCACTTTGGGAGGTCAAGG - Intergenic
961411557 3:126725617-126725639 TCTAAGACTTTCATAGCTAGAGG - Intronic
961979954 3:131066581-131066603 CCTAGCACTTTGAGAGGTCAAGG + Intronic
963146184 3:141997597-141997619 CCTAGCACTTTGAGAGGCAAAGG + Intronic
963532664 3:146490281-146490303 TCTCAGGCCTTGAGAGCTAATGG - Intronic
965500570 3:169451040-169451062 TCTAGATCTTTGTTAGCTAAAGG + Intronic
965866569 3:173212127-173212149 TCTAGCACTTTGAGAGGCCAAGG - Intergenic
966758285 3:183392001-183392023 TCTAGCACTTTGGGAGCCCAAGG - Intronic
966814169 3:183875798-183875820 TCTAAGACTTTCATAGCTACAGG + Intronic
967590921 3:191272912-191272934 CCCAGCACTTTGAGAGCTCAAGG + Intronic
967618013 3:191597011-191597033 TCTAGTGCTTTGAGAGGTCAAGG - Intergenic
968893198 4:3383354-3383376 CCTAGCACTTTGAGAGGTCAAGG + Intronic
969060282 4:4428617-4428639 TCTAGGACTTTGAGACTAGAGGG - Intronic
970368825 4:15387678-15387700 TCAAGGACTTTGAGATGAAAGGG + Intronic
970645587 4:18116914-18116936 TGAAGGACTTTGAGAACTAAAGG + Intergenic
971315326 4:25563211-25563233 CCTAGCACTTTGGGAGCTCAAGG - Intergenic
972827448 4:42776521-42776543 TTTAGGACTTTGAGAGACTATGG - Intergenic
973139275 4:46746127-46746149 TCTAGGTCTTTCAGATCTGATGG - Intronic
973990508 4:56402294-56402316 TCTATGACTTTAAGAGCACATGG + Intronic
974497259 4:62648120-62648142 TCTAGGATTTTTATAGCTACAGG + Intergenic
974973194 4:68856602-68856624 TCTAAGACTTTCAAAGCTACAGG + Intergenic
975777389 4:77802515-77802537 TCTCTGACTTTGAAAACTAAGGG + Intronic
976329261 4:83810288-83810310 TCTTGCACTTTGAAAGCTAGTGG + Intergenic
976415408 4:84768340-84768362 TCTAGGACTTTCATAGCTAGAGG + Intronic
976885309 4:89976023-89976045 TGTAGGACTTTCATAGCTAAAGG - Intergenic
977173471 4:93791355-93791377 TCTAGAACTTTAAGAACTTAAGG + Intergenic
977517558 4:98040430-98040452 TCTAGGATTTTTAGAGCTTCAGG + Intronic
978033503 4:103966910-103966932 TCTAGCACTTTGGGAGGTCAAGG - Intergenic
978497022 4:109370519-109370541 TCTAGCACTTTGAGAGGCCAAGG + Intergenic
978762974 4:112375073-112375095 TCTAGGACTTTCATATCTAGAGG - Intronic
979236095 4:118402011-118402033 CCTAGGACTTTGTGAGGTCAAGG + Intergenic
980399589 4:132263716-132263738 TCTAGCACTTTGGGAGGTGAAGG + Intergenic
980431742 4:132708723-132708745 TCTAGCACTTTGAGAGGTTGAGG - Intergenic
981200738 4:141976431-141976453 TCTAAGACTTTCATAGCTAGAGG + Intergenic
981369956 4:143948666-143948688 CCTAGCACTTTGGGAGCTGAAGG - Intergenic
982286233 4:153738433-153738455 TCCAGCACTTTGAGAGCCCAAGG - Intronic
982453558 4:155580492-155580514 TCTAGGACTTTTATATCTACAGG + Intergenic
982725738 4:158903630-158903652 TCTAGTACTTTTAGTGCTACTGG - Intronic
983028541 4:162768930-162768952 TCTAGCACTTTGAGAGGCCAAGG + Intergenic
983043229 4:162954978-162955000 TTAAGGACTTTAAGAGCTAAAGG + Intergenic
983290189 4:165792890-165792912 TCCAGGACTTTCATAGCTATAGG - Intergenic
984971874 4:185198943-185198965 TCTAGGATTTTCATAGCTAGAGG + Intronic
987256684 5:16161416-16161438 TTACGGACTCTGAGAGCTAAAGG + Intronic
990548528 5:56848955-56848977 TTTAGGCCTTTGAGAGATATGGG - Intronic
991029815 5:62071232-62071254 TCTATGTCTTTGAAAGCTCATGG + Intergenic
991240064 5:64448060-64448082 GCCAGGAATTTGAGAGCAAATGG + Intergenic
992115700 5:73536714-73536736 CCTAGCACTTTGAGAGGTCAAGG + Intergenic
992375957 5:76188006-76188028 CCCAGCACTTTGGGAGCTAAGGG + Intronic
992704070 5:79370118-79370140 TCTAGCACTTTGGGAGGTCAAGG + Intergenic
993252554 5:85548261-85548283 TCTAGGAGGTTGTGAGCTCAGGG + Intergenic
994584518 5:101689253-101689275 GCAAGGACTTTGGTAGCTAATGG + Intergenic
994793948 5:104269185-104269207 CCTAGCACTTTGAGAGGTCAAGG - Intergenic
995001562 5:107137320-107137342 TCCAGGACTTTAATAGCTAGAGG - Intergenic
995260113 5:110093833-110093855 ACTAGGTCTTTGATACCTAAAGG - Intergenic
996042709 5:118833726-118833748 TCTAGGACTTTGGGAGGCCAAGG + Intergenic
996701894 5:126458182-126458204 CTTAGCACTTTGAGAGGTAAAGG + Intronic
997190130 5:131924932-131924954 TCTAGGAGTTTTACAGCTTAAGG + Intronic
997577190 5:134989353-134989375 TCTAGGACTTTCATAGCTACAGG - Intronic
998224624 5:140317101-140317123 TCCAGCACTTTGGGAGCTTAAGG + Intergenic
998465063 5:142337142-142337164 TCTAGCACTTTGGGAGGTGAAGG + Intergenic
999290920 5:150425517-150425539 TCTAGCACTTTGGGAGATCAAGG + Intergenic
999897151 5:156047371-156047393 TCTAGGACTTTCATAGCTAAAGG + Intronic
999979925 5:156948234-156948256 TCTAGAACTTTGAGAGGCCAAGG + Intronic
1002404353 5:179018131-179018153 TCTAGCACTTTGGGAGCCCAAGG + Intergenic
1002865722 6:1120728-1120750 CCTAGCACTTTGGGAGGTAAAGG + Intergenic
1003008021 6:2399460-2399482 TCTAGGACTTAGAGTCCTAAGGG - Intergenic
1003450557 6:6227674-6227696 TCTATGAATTTCAGAGGTAAAGG + Intronic
1003848219 6:10196052-10196074 TCTAGGATAGTGAAAGCTAAAGG - Intronic
1003915878 6:10785992-10786014 TCTAGCACTTTGAGAGGCAAAGG + Intronic
1004162900 6:13230231-13230253 GCTAGAACCTGGAGAGCTAAAGG - Intronic
1004498696 6:16189438-16189460 TCCAGCACTTTGAGAGGTCAAGG + Intergenic
1004575928 6:16894786-16894808 CCTAGAACTTTGAGAGGTCAAGG + Intergenic
1005407915 6:25511457-25511479 AATAGGACTTTGAGAGGAAACGG - Intronic
1006428574 6:33981514-33981536 TCTAGCACTTTGAGAGGCCAAGG - Intergenic
1006587272 6:35124042-35124064 TCTAGCACTTTGAGAGGCCAAGG - Intronic
1006875759 6:37294481-37294503 TCTAGGACTTTCATAGCTAGAGG + Intronic
1009346512 6:62618371-62618393 TATAGGATTTTGTGAGCCAAGGG - Intergenic
1009426088 6:63514952-63514974 TCTAGCACTTTGGGAGGTCAAGG - Intergenic
1009984245 6:70764160-70764182 TCTAGCACTTTGAGAGGGTAAGG - Intronic
1010433955 6:75809395-75809417 TCAAGGACTTAGAGTGTTAATGG + Intronic
1010724537 6:79318290-79318312 TCTAGGACTTTCATAGCTAGAGG - Intergenic
1010867646 6:80999260-80999282 CCTAGCACTTTGAGAGGTAGAGG - Intergenic
1011653544 6:89529133-89529155 TCTAAGACTTTCATAGCTAGAGG - Intronic
1012086993 6:94840362-94840384 TATAGGTCATTGGGAGCTAATGG + Intergenic
1012161560 6:95890950-95890972 TCTAGCACTTTGAGAAGTCAAGG - Intergenic
1013773811 6:113656876-113656898 TCTAGGACTTTGGGAGGTTGAGG - Intergenic
1014177673 6:118348368-118348390 TCTAGCACTTTGGGAGGCAAAGG - Intergenic
1015562294 6:134529542-134529564 TCTAGCACTTTGAGAGGCTAAGG + Intergenic
1015861191 6:137682020-137682042 CCTAGGACTTTGAGAGTCCAAGG - Intergenic
1016118514 6:140318268-140318290 TCTAGGAGTTTCCAAGCTAATGG - Intergenic
1017391984 6:153950246-153950268 TCCAGCACTTTGAGAGGTCAAGG + Intergenic
1018516273 6:164583101-164583123 TCTAGGATTTTGATAGACAAAGG - Intergenic
1019489409 7:1304779-1304801 TCCAGCACTTTGAGAGGTAGAGG - Intergenic
1021205391 7:17773785-17773807 TCTAGGACATTGAGAGCACAAGG - Intergenic
1021263454 7:18488548-18488570 TCTAGAATTTTGAGCGCAAATGG + Intronic
1021495327 7:21268232-21268254 CCTAGCACTTTGAGAGGTCAAGG + Intergenic
1022199346 7:28101486-28101508 TCTAGCACTTTGAGAGGTTGAGG + Intronic
1022659661 7:32355082-32355104 TCTAGGGCTTTAAGAGCTTTGGG - Intergenic
1024143274 7:46483712-46483734 TATTGAACTTTGAGAGCTATCGG - Intergenic
1024479949 7:49852774-49852796 TCTGGGAGTTTGAGAGCAGAGGG - Intronic
1025098852 7:56118662-56118684 TCTAGCACTTTGGGAGGTCAGGG - Intergenic
1026289131 7:68990165-68990187 TCTAGAACTTTGGGAGGTCAAGG + Intergenic
1026546024 7:71322884-71322906 TCTAGAACTATGAGACATAAAGG + Intronic
1026549717 7:71357654-71357676 TCTAGCACTTTGGGAGGTCAAGG + Intronic
1026572929 7:71547535-71547557 CCTAGCACTTTGAGAGGGAAAGG - Intronic
1026864212 7:73812777-73812799 TCTAGCACTTTGGGAGGCAAAGG - Intronic
1026974346 7:74488028-74488050 TCTAGCACTTTGGGAGCCCAAGG + Intronic
1027171663 7:75877246-75877268 TCCAGGACTTTGAGAGGTCAAGG + Intronic
1027392189 7:77715557-77715579 TCTAGCACTTTGAGAGGCTACGG - Intronic
1030141513 7:106308996-106309018 TCTAGCACTTTGGGAGGTCAAGG - Intergenic
1031187306 7:118499045-118499067 TCTGGCACTTTGAGAGGTCAAGG - Intergenic
1031401527 7:121329909-121329931 TCTGGAACTTAGAGAGCTACAGG - Intronic
1031940049 7:127778924-127778946 TCTAAGTCTTTTAGACCTAAGGG - Intronic
1032533767 7:132643698-132643720 TCCAGGACTTTGAGAGGCCAAGG + Intronic
1032876037 7:136039143-136039165 TCTTAGAGTTTGAAAGCTAAGGG + Intergenic
1033080508 7:138292511-138292533 GCTAGGACTTTCATAGCTAGAGG - Intergenic
1033241736 7:139685513-139685535 TCTAGGACTTTCGTAGCTAGAGG + Intronic
1038111447 8:24504115-24504137 TCTAGCACTTTGAGAGGCCAAGG + Intronic
1038117617 8:24575278-24575300 TCTAGGAATTTCAGGGCAAAGGG - Intergenic
1038297040 8:26302927-26302949 TCTAAGATTTTAAGAGTTAAGGG + Intronic
1038424667 8:27457146-27457168 TCTAGGACTTTCATAGCTAGAGG + Intronic
1038633962 8:29270648-29270670 TCTAGCACTTTGGGAGGTCAAGG - Intergenic
1039353487 8:36789103-36789125 TCTAGCACTTTGAGAGGCAGAGG + Intronic
1039874174 8:41571454-41571476 TCTAGCACTTTGAGAGGCCAAGG + Intergenic
1040029512 8:42811955-42811977 CCTAGCACTTTGAGAGGTCAAGG + Intergenic
1040503557 8:48026561-48026583 TATAGAACAGTGAGAGCTAAAGG - Intronic
1040918102 8:52584657-52584679 CCTAGTACTTTGGGAGGTAAAGG - Intergenic
1041060553 8:54030869-54030891 TCTAGCACTTTGAGAGGCCAGGG - Intergenic
1042548066 8:69968729-69968751 TCTAGGACTTTCATAGCTAAAGG + Intergenic
1042575043 8:70208522-70208544 TCTAGGACTTTCATAGCTAGAGG + Intronic
1042803962 8:72751873-72751895 TCAAGAAGTTTGAAAGCTAATGG + Intronic
1043221383 8:77670133-77670155 TCTAGGGTTTTGATAGCTTAGGG - Intergenic
1043877731 8:85505428-85505450 TCTAGCACTTTGGGAGGCAAAGG - Intergenic
1046347400 8:112949910-112949932 GATAGGATTTTGATAGCTAAAGG - Intronic
1046825497 8:118686799-118686821 CCCAGCACTTTGAGAGGTAAAGG - Intergenic
1047196705 8:122728321-122728343 TCTATGACTTTGGGAGCACACGG - Intergenic
1047637007 8:126774911-126774933 TCTAGCACTTTGGGAGCCCAAGG + Intergenic
1048130674 8:131693757-131693779 TTTAGAACTTTGAGAATTAATGG - Intergenic
1048630476 8:136237100-136237122 TCTAGAATTTGGAGAGGTAATGG + Intergenic
1048679356 8:136822543-136822565 TCTAGGATTTTTAGAGTTTAAGG - Intergenic
1048902518 8:139052605-139052627 TCTAGGACTTTCATAGTTAGAGG + Intergenic
1049034676 8:140065447-140065469 TCTAGGACTTTCATAGCTGGAGG + Intronic
1049101382 8:140581262-140581284 TCTAGCACTTTGAGAGGCCAAGG + Intronic
1049136687 8:140908492-140908514 TCTAGGACTTTGACAGCTAGAGG + Intronic
1049314244 8:141951953-141951975 TCTAGGACTTTCACAGCTAGAGG + Intergenic
1050565065 9:6873332-6873354 TCTAGGACTTTCACAGATAGAGG - Intronic
1050634655 9:7598446-7598468 TCTAGGATATTGAGAGCAAATGG - Intergenic
1051210709 9:14739352-14739374 CCTAGGACTTTGAGAGACCAAGG - Intronic
1051305335 9:15702612-15702634 CCTAGGACTTTTACAGCTAGAGG - Intronic
1051388907 9:16542173-16542195 TCAAAGACTTTGAGAACCAAAGG - Intronic
1052194496 9:25694865-25694887 TCTAGCACTTTGGGAGATCAAGG - Intergenic
1052283323 9:26756926-26756948 TCTAGAACTTTGGGAGGTTAAGG - Intergenic
1052577371 9:30307275-30307297 TCTAGGACTTTGGGAGGCCAAGG - Intergenic
1052896762 9:33754577-33754599 TCTAGCACTTTGGGAGGTCAAGG + Intronic
1053182201 9:35982349-35982371 TCTAGGACTTTTAGAGCTGGTGG - Intergenic
1053421324 9:37981150-37981172 TCTAGGACTTTCAGAGCCATAGG - Intronic
1053615383 9:39760383-39760405 TCCAGGACTTTGAGAGACCAAGG - Intergenic
1053873548 9:42519653-42519675 TCCAGGACTTTGAGAGACCAAGG - Intergenic
1053899069 9:42774881-42774903 TCCAGGACTTTGAGAGACCAAGG + Intergenic
1054238137 9:62582008-62582030 TCCAGGACTTTGAGAGACCAAGG + Intergenic
1054262445 9:62881322-62881344 TCCAGGACTTTGAGAGACCAAGG - Intergenic
1054268784 9:62947098-62947120 TCCAGGACTTTGAGAGAACAAGG + Intergenic
1054552268 9:66616524-66616546 TCCAGGACTTTGAGAGACCAAGG + Intergenic
1055446807 9:76392654-76392676 TCTAGGACTTTGAGAGGCCAAGG + Intronic
1058278914 9:103086062-103086084 CCTAGGACTTTGGGAGGTCAAGG - Intergenic
1058628091 9:106956587-106956609 TCTAGGACTTTCACAGCTAAGGG - Intronic
1059027402 9:110649806-110649828 TCTAGGACTTGGATAAGTAATGG - Intergenic
1059211583 9:112516191-112516213 TCTAGCACTTTGAGAGGCCAAGG + Intronic
1061494697 9:130965773-130965795 TCTAGGACTTTCATAGCTAGAGG + Intergenic
1061998480 9:134202882-134202904 CCTAGCACTTTGAGAGGTCAAGG + Intergenic
1185768688 X:2748128-2748150 CCCAGGACTTTGAGAGCCAGAGG - Intergenic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1186627141 X:11306330-11306352 TCAAGGAGCTTGACAGCTAAGGG - Intronic
1187539033 X:20172576-20172598 TCTAGAACCCTGTGAGCTAAAGG - Intronic
1187649535 X:21387229-21387251 TCTAGCACTTTGAGAGGTTGAGG + Intronic
1187711302 X:22057351-22057373 CCTAGCACTTTGAGAGGTCAAGG + Intronic
1187800503 X:23057042-23057064 TCTAGAACTTTCATAGCTAGAGG + Intergenic
1189733792 X:44048997-44049019 CCTAGTACTTTGAGAGGTCAAGG + Intergenic
1189827885 X:44938691-44938713 TGTAGGACTTTGATAGCTAGAGG + Intronic
1190590822 X:51998758-51998780 TCTAGGACTTTTATAGTTTAAGG + Intergenic
1192743278 X:73913959-73913981 TCTAGCACTTTGAGAGGCCAAGG + Intergenic
1193902359 X:87197211-87197233 TTTAGGACTTTGAGAAATAATGG - Intergenic
1193971836 X:88064932-88064954 TCTTGGACTTTTTTAGCTAATGG - Intergenic
1194072597 X:89345635-89345657 TCTAGGACTTTTATAGTTAAAGG + Intergenic
1194398687 X:93417243-93417265 CCTAGGAGTTTGAGAGCTAGGGG + Intergenic
1195483901 X:105380396-105380418 TTTCAGACTTTGAGAGCTTATGG + Intronic
1196830325 X:119770893-119770915 TCTAGGACTTTGGGAGGTCAAGG + Intergenic
1196857913 X:120000702-120000724 TCGAGGACTTTGAGTGCGAACGG - Intergenic
1197271222 X:124426725-124426747 GCTAGGAATTTGAGTGCTAATGG + Intronic
1199751144 X:150819316-150819338 TATAGGATATTGAGAGCAAATGG - Intronic
1200726836 Y:6681384-6681406 TCTAGGACTTTTATAGTTAAAGG + Intergenic
1200727988 Y:6697160-6697182 TCTAGGACTTTTATAGTTAAAGG + Intergenic
1200821722 Y:7591228-7591250 TCCAGCACTTTGAGAGGTCAGGG + Intergenic
1200876777 Y:8164634-8164656 TCCAGCACTTTGAGAGGTCAAGG + Intergenic
1202103742 Y:21339483-21339505 TCTAGCACTTTGAGAGATCAAGG + Intergenic
1202238583 Y:22741526-22741548 TCCAGCACTTTGAGAGGTCAGGG - Intergenic