ID: 1065491684

View in Genome Browser
Species Human (GRCh38)
Location 10:26288677-26288699
Sequence ACTTGAAGTAAGAGAGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 6, 3: 25, 4: 313}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065491684_1065491685 -9 Left 1065491684 10:26288677-26288699 CCAAGTTCTCTCTTACTTCAAGT 0: 1
1: 0
2: 6
3: 25
4: 313
Right 1065491685 10:26288691-26288713 ACTTCAAGTATCATTCTTTGTGG No data
1065491684_1065491686 7 Left 1065491684 10:26288677-26288699 CCAAGTTCTCTCTTACTTCAAGT 0: 1
1: 0
2: 6
3: 25
4: 313
Right 1065491686 10:26288707-26288729 TTTGTGGCTTTTTTCCCCTGTGG No data
1065491684_1065491688 21 Left 1065491684 10:26288677-26288699 CCAAGTTCTCTCTTACTTCAAGT 0: 1
1: 0
2: 6
3: 25
4: 313
Right 1065491688 10:26288721-26288743 CCCCTGTGGTGTTTTTATTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065491684 Original CRISPR ACTTGAAGTAAGAGAGAACT TGG (reversed) Intronic
900254581 1:1691393-1691415 ACTAGAAGGAAAAGAAAACTTGG + Exonic
900263333 1:1744668-1744690 ACTAGAAGGAAAAGAAAACTTGG + Intronic
905389688 1:37628487-37628509 ACATGAAGCAAGAGGGAGCTGGG + Intronic
905581186 1:39083443-39083465 ACTTGAAGTAAGACAGACCTGGG - Intronic
906919044 1:50043800-50043822 ACTTGACATAAGATAGAACATGG - Intergenic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
907868215 1:58419210-58419232 ACTTGGAGTAAGATACATCTAGG + Intronic
908224953 1:62046535-62046557 ATTTGAAGTAAAACAGACCTAGG + Intronic
908896266 1:68903715-68903737 ACTTGCAGTAAAAGAGCAGTGGG - Intergenic
909764549 1:79339174-79339196 ACTTTTAGTTAGAGAGAATTAGG - Intergenic
912217260 1:107628534-107628556 AGTTGAGCTTAGAGAGAACTTGG - Intronic
912245807 1:107960602-107960624 ACGTGAAGTCAGAGAGAAAATGG - Intronic
912569758 1:110612884-110612906 ACTTGAAGTCAGACAGGCCTGGG + Intronic
912648811 1:111420172-111420194 TCTTGAAGGCAGGGAGAACTAGG + Intronic
914697222 1:150095688-150095710 TCTTGAAGAAAGAGAGAATTTGG + Intronic
915644687 1:157260920-157260942 AGTTGAAGTAAGAGAAGTCTTGG - Intergenic
916286017 1:163106639-163106661 CCTTGAGTTAAGAAAGAACTTGG + Intergenic
916608690 1:166368332-166368354 ACTTGGTGTAAGACAGACCTGGG + Intergenic
918646062 1:186906045-186906067 ACTTCAAGTAGAACAGAACTAGG - Intronic
921256602 1:213346909-213346931 ACTAGTGGTAAGAGAGGACTAGG - Intergenic
921426999 1:215015171-215015193 ACTAGAGATAAGAGAGAAATTGG - Intronic
922073864 1:222222765-222222787 ACTTGAAGTCAAAGTGACCTTGG - Intergenic
923472103 1:234300864-234300886 AGTTGAAGTGAGAGAGAATAAGG + Intronic
923857436 1:237860140-237860162 CCTGGAAGAAAGAAAGAACTGGG - Intergenic
924445438 1:244125747-244125769 ACTTGGAGTCAGCGAGACCTAGG - Intergenic
924593430 1:245424760-245424782 ACTAGAAGTAAAAGAAAAATTGG + Intronic
1064120978 10:12618978-12619000 CTTTGGAGTAAGAGAAAACTGGG - Intronic
1065186765 10:23175883-23175905 TCTTAAAGTAATAGAGAAGTTGG + Intergenic
1065491684 10:26288677-26288699 ACTTGAAGTAAGAGAGAACTTGG - Intronic
1065634046 10:27712427-27712449 AGTTGAAGCAGGAGAGACCTGGG + Intronic
1066513553 10:36129680-36129702 ACATGAAATAAGAGAAAAATAGG - Intergenic
1071136359 10:82458651-82458673 CCTTGGAGTAAGATAGACCTGGG + Intronic
1071174799 10:82913317-82913339 ATTTGAACTAACAGATAACTGGG - Intronic
1072484301 10:95840227-95840249 ACTTGAAGTCGGGCAGAACTTGG - Intronic
1073999732 10:109358654-109358676 ACTTGAAGTGAGACTAAACTGGG - Intergenic
1074293723 10:112162195-112162217 ACTTGAAGTCAGAAAAATCTGGG + Intronic
1074954444 10:118374460-118374482 AATAGATGTAAGAGAAAACTGGG - Intergenic
1076274642 10:129186778-129186800 ACTTGAAGAAAGAAAGAAGTGGG + Intergenic
1078309399 11:10224596-10224618 ACTTTAGGTATGAAAGAACTTGG - Intronic
1079680392 11:23289568-23289590 GCTTGAAGTCAGAGAGTCCTAGG - Intergenic
1080104108 11:28493913-28493935 TCTTGCAATATGAGAGAACTAGG + Intergenic
1080979292 11:37380945-37380967 AATTGAACAAAGAGAAAACTTGG - Intergenic
1081059678 11:38458531-38458553 ATTTGGAGTCAGAGAGAATTGGG + Intergenic
1081385099 11:42462758-42462780 CTTTGAAGTCAGGGAGAACTAGG - Intergenic
1081841515 11:46204984-46205006 ACTTGGAGAAAGAGAGAAGAGGG + Intergenic
1082764228 11:57154375-57154397 ACTTTAAGAAAGTGAGAAATAGG + Intergenic
1082817959 11:57522811-57522833 ACTTGAGGTAGGAGAGAGCATGG - Intergenic
1083378792 11:62247422-62247444 TGATGAAGTGAGAGAGAACTTGG - Intergenic
1085132112 11:74049480-74049502 ACTGGAAGCCAGAGAGAAGTGGG + Exonic
1086281814 11:85198788-85198810 ACTTGAGGTAAGAGAAAGATGGG - Intronic
1086283565 11:85219411-85219433 CCTTGAAGACAGAGAGAACTAGG + Intronic
1087992675 11:104765230-104765252 CTTTGAAGTAATAGAGACCTAGG - Intergenic
1089058900 11:115609841-115609863 CCTTGAAGTAGCTGAGAACTTGG - Intergenic
1090408852 11:126493833-126493855 CCTTGAAGGAAGGGAGAAGTAGG - Intronic
1092050292 12:5464718-5464740 AGTGCAAGTAAGAGAGAACATGG - Intronic
1092317181 12:7430017-7430039 TCCTGAAGTAAGAAAGGACTTGG - Intronic
1093258378 12:16901815-16901837 ATTTGAAGAAATAGTGAACTGGG + Intergenic
1093777855 12:23098388-23098410 TCTTTAAGTAAAAGAGAAATGGG - Intergenic
1094246427 12:28300687-28300709 ACATTAATTAAGAGAGGACTGGG + Intronic
1094277901 12:28699612-28699634 CCTTAAAAGAAGAGAGAACTTGG + Intergenic
1095513073 12:42975006-42975028 ACTTAAAGTAAGAAAGCACAGGG + Intergenic
1096052812 12:48626177-48626199 ACTTGAATTGAGAGTGAAATAGG - Intergenic
1096789918 12:54038230-54038252 ACTTGCAGTCAGAGAGAATAAGG - Intronic
1096983095 12:55739894-55739916 ACCTGAAGAAAGAGTAAACTTGG + Intergenic
1098414858 12:70221290-70221312 CTTTGAAGTCAGAAAGAACTGGG + Intergenic
1099148780 12:79081678-79081700 ACTTGTAGAAAAAGTGAACTTGG - Intronic
1099991955 12:89732420-89732442 TATAGAAGTAAGAGAGAAATGGG - Intergenic
1101261073 12:103030730-103030752 ACTAGAAGCATGAGAGAACCTGG - Intergenic
1101580659 12:106038585-106038607 CCGTGGAGTTAGAGAGAACTGGG + Intergenic
1102934789 12:116887358-116887380 ACTTGGAGCCAGAGAGACCTGGG + Intergenic
1103750289 12:123153948-123153970 ACTTGGAGCCAGAGAGACCTGGG - Intronic
1104156627 12:126139220-126139242 ATTTGAAGTTAGAGAGAACAGGG + Intergenic
1104869224 12:131982668-131982690 TATTAAAGTAATAGAGAACTGGG + Intronic
1105669921 13:22601793-22601815 ACTTGGAGTTGGAGAGACCTGGG - Intergenic
1107266208 13:38558600-38558622 ACCTCAAATAAGAGTGAACTTGG + Intergenic
1108219820 13:48222001-48222023 ACATAAAGGAAGAGAGAAATTGG - Intergenic
1108605434 13:52032780-52032802 GCTGAAAATAAGAGAGAACTGGG - Exonic
1109314423 13:60733608-60733630 ATTTGACAAAAGAGAGAACTAGG - Intergenic
1111359794 13:87161234-87161256 AATTGAAATAAGTGAGACCTGGG + Intergenic
1111482827 13:88854291-88854313 TCTTGAACTAAGACAGAAATTGG + Intergenic
1112776588 13:102850304-102850326 CCTTAGAGTAGGAGAGAACTAGG + Intronic
1113141695 13:107159373-107159395 CCTCAAAGTAAGAGAGAAATAGG - Intergenic
1114130643 14:19787928-19787950 ACTTGAAGACAGAGAGAAACAGG - Intronic
1115517903 14:34204550-34204572 ACCTTAAGGATGAGAGAACTGGG - Intronic
1117456658 14:55904543-55904565 ACTGGAACTAAGATAGCACTGGG - Intergenic
1117479720 14:56130366-56130388 ACTTGGAGTCAGAAAGACCTAGG - Intronic
1117689661 14:58293547-58293569 ACTTGAAGAAAGAGAGGTCCAGG + Intronic
1118798906 14:69171316-69171338 AATTGAAGTCAGAGAGGCCTGGG + Intergenic
1120877376 14:89387530-89387552 AGTTGGAGTCAGAGAGACCTAGG - Intronic
1122978442 14:105180747-105180769 ACTTGAAGGAGGAGATAGCTGGG - Intronic
1123573699 15:21643564-21643586 ACTTGAAGACAGAGAGAAACAGG - Intergenic
1123610318 15:22086149-22086171 ACTTGAAGACAGAGAGAAACAGG - Intergenic
1126404897 15:48313740-48313762 ACTTGAAGGAAGTGATATCTTGG - Intergenic
1126522455 15:49611888-49611910 ATTTGAAGTAAGAGTTAAATAGG - Intronic
1126834522 15:52646296-52646318 TCTTGAACAAAGATAGAACTGGG + Intronic
1126885752 15:53147919-53147941 AAATGAAGTCAGAGAGAATTGGG + Intergenic
1126969717 15:54096776-54096798 GCTTGAAGTAAGAGAGATCTAGG + Intronic
1127214731 15:56812417-56812439 ACTACAAGTAAGAGACAACTGGG + Intronic
1128348199 15:66868678-66868700 ATTTGAAGTATGATTGAACTGGG + Intergenic
1129448451 15:75635212-75635234 ACCTGGAGTCAGAGAGAACTAGG + Intergenic
1130199871 15:81815104-81815126 ACTTGAAGGAAGAGAAAAAGCGG + Intergenic
1130895208 15:88164688-88164710 ACTGGAAGTAAGACAGAGATGGG - Intronic
1131334531 15:91535237-91535259 ACTTGGAGGAAAACAGAACTAGG - Intergenic
1131355587 15:91742970-91742992 AGTTGAAGGCAGAGAGAAGTGGG - Intergenic
1131624097 15:94099733-94099755 ACTGGAAGTTAGGGAGAATTGGG - Intergenic
1131690468 15:94821860-94821882 ATTTGAAGTCAGGGAGAGCTAGG - Intergenic
1131757428 15:95580460-95580482 ACTTGAATTAAAAGAGTACTAGG + Intergenic
1202982565 15_KI270727v1_random:377903-377925 ACTTGAAGACAGAGAGAAACAGG - Intergenic
1135307425 16:21379143-21379165 ACAGGAAGTCAGAGAGAGCTTGG + Intergenic
1135933585 16:26760335-26760357 AGGTGAAGTGAGAGAGACCTTGG - Intergenic
1136304169 16:29358281-29358303 ACATGAAGTCAGAGAGAGCTTGG + Intergenic
1137514293 16:49129751-49129773 CTTTGAAGTAAAAAAGAACTTGG - Intergenic
1137777703 16:51070329-51070351 AGTGGAAGTAAGAGAGAACTTGG + Intergenic
1138070007 16:53983540-53983562 ACTTGAAGGCAGAGAGAAAAGGG - Intronic
1138437341 16:57010744-57010766 ACGTGAAATAAAAGAGAAATAGG - Intronic
1138894059 16:61181550-61181572 CCTTGTAGTAATAGGGAACTTGG - Intergenic
1139423128 16:66861562-66861584 ACTTGAAGGAGGAGAGAAAGTGG + Intronic
1141543998 16:84750792-84750814 AATTCCAGTGAGAGAGAACTAGG + Intronic
1141973680 16:87499721-87499743 TCTGGAAGGGAGAGAGAACTAGG + Intergenic
1144469677 17:15526734-15526756 GCTACAAGCAAGAGAGAACTGGG + Intronic
1149027837 17:52050650-52050672 CCTTGAAGTGAGAAAGAGCTTGG - Intronic
1149927134 17:60712548-60712570 ATTTGAATTCAGACAGAACTAGG - Intronic
1150049960 17:61952235-61952257 ATTTGAAGTAAAAACGAACTGGG - Intronic
1150990464 17:70251852-70251874 ACTTTAAGAAAGAGATAACATGG - Intergenic
1154093740 18:11390174-11390196 TCTTCAAGTCAGAGAGAACTTGG - Intergenic
1154128053 18:11711765-11711787 ACATGAAGAAAGAGGGAAATGGG - Intronic
1154929448 18:20977091-20977113 AATTGAAGTAAGGGAAAGCTGGG - Intronic
1155162287 18:23205859-23205881 TCTTGAAGTAAGGGAAAACTGGG + Intronic
1156541884 18:37920405-37920427 ACTTGATGTAAAAAATAACTGGG + Intergenic
1157189565 18:45569265-45569287 ACCAGTAGAAAGAGAGAACTGGG - Intronic
1157251148 18:46097413-46097435 AATTCAAGTAAAAGAGAACAAGG - Intronic
1159563641 18:70023479-70023501 ACTTGAAGTGAGAAAGTAGTAGG - Intronic
1159935096 18:74359578-74359600 ACTTGAACGAAGAGAGCACATGG + Intergenic
1162719736 19:12655335-12655357 ATTTGAAGGAAGAGAGATCCAGG - Intronic
1165527035 19:36364797-36364819 ATTTGATGAAAGAGAGAATTTGG - Intronic
1167738597 19:51311440-51311462 ACTTGAAGGAGGAGGGAGCTGGG + Intergenic
1168265705 19:55222985-55223007 ACTACAAGTAAGAGACAACTGGG - Intergenic
925519233 2:4723327-4723349 ACGGGAAGTCAGAGAGTACTTGG - Intergenic
926236495 2:11049210-11049232 ACTTGAAGGAAGAGAGAAGAGGG - Intergenic
927087070 2:19682816-19682838 AAAAGAAGTAAGAGAAAACTTGG + Intergenic
927371592 2:22362011-22362033 ACATGAGGTAAATGAGAACTGGG - Intergenic
927387985 2:22558562-22558584 CCTTGAAGTGAGAGAGAGCACGG + Intergenic
927628150 2:24745852-24745874 CCTGGAAGTAAAAGAGAACAAGG - Intronic
928462969 2:31492641-31492663 AATTGAACAAAGAGAGCACTTGG + Intergenic
928812353 2:35244450-35244472 ATTTGAAGTCAGACATAACTGGG + Intergenic
929182308 2:39055028-39055050 ACTAGTAGTGATAGAGAACTTGG - Intronic
929862014 2:45686439-45686461 ACATGCAGAAAGAGAGAAATTGG + Intronic
931677193 2:64709184-64709206 ACTTTCAGTGAGAGAGAAATTGG - Intronic
934580232 2:95431942-95431964 ACTCAAAGTCAGAGAGACCTGGG - Intergenic
934599214 2:95644772-95644794 ACTCAAAGTCAGAGAGACCTGGG + Intergenic
934676044 2:96250308-96250330 ACTTGATGTGGGAGTGAACTGGG - Exonic
935868395 2:107417542-107417564 CCTTGAAGGAAGAGAGAGCATGG + Intergenic
936532566 2:113286770-113286792 ACTCAAAGTCAGAGAGACCTGGG + Intergenic
938179995 2:129172221-129172243 AATGGAAGAAATAGAGAACTGGG + Intergenic
938336499 2:130504736-130504758 ACTTTAAGTCAAAGAAAACTTGG + Intronic
938353324 2:130615926-130615948 ACTTTAAGTCAAAGAAAACTTGG - Intronic
938745897 2:134277983-134278005 ACTTAAACTAAAAGGGAACTTGG + Intronic
938965344 2:136383215-136383237 GCCTAAAGGAAGAGAGAACTTGG - Intergenic
939048637 2:137280632-137280654 CCTTGAAGTATGAGACAACTAGG - Intronic
939410177 2:141814765-141814787 ACTGGAAACAAAAGAGAACTGGG + Intronic
942354881 2:175099794-175099816 ACTTGAAATTAAAGAGATCTGGG - Intronic
943164974 2:184310413-184310435 ACTTCAAGAAAAAGATAACTCGG + Intergenic
943539212 2:189191024-189191046 ACTTGAAGTCACAAGGAACTTGG + Intergenic
944015482 2:195031389-195031411 ATTTGCAGTAAGAGAGAATGTGG - Intergenic
944272651 2:197801180-197801202 GCTTGAAGTTAGAGCCAACTAGG - Intergenic
945000895 2:205349193-205349215 ACAGGAAATAAGAGAGAAATTGG + Intronic
945647764 2:212521565-212521587 AGTAGTAGTAGGAGAGAACTAGG - Intronic
946085595 2:217168240-217168262 ACTGGAAGAAAGGGAGAACATGG - Intergenic
946268148 2:218566814-218566836 ATTGGAAGTAGGATAGAACTTGG + Intronic
947168753 2:227289835-227289857 CCTTCAAATAAGAGGGAACTAGG - Intronic
947234324 2:227923864-227923886 ACTTGTAGAAAGAGAGAATGAGG + Intronic
947700291 2:232228532-232228554 AAATGAAGTAGCAGAGAACTGGG - Intronic
1169673109 20:8126251-8126273 ATCTGAAGTGAGAGAGAATTGGG + Intergenic
1170058205 20:12230393-12230415 ATTTCAAGTAAGAGAGAAGCTGG - Intergenic
1170243141 20:14192485-14192507 ACTTTAAGTAAGATAGATGTGGG + Intronic
1170536439 20:17345704-17345726 ATTTCAAGTAAGAAAGAACTGGG - Intronic
1170579815 20:17689896-17689918 AGTGGTAGTAAAAGAGAACTTGG + Intergenic
1170982171 20:21224568-21224590 CCTTGAACCAACAGAGAACTGGG - Intronic
1171320896 20:24243291-24243313 TGTTGGAGTAAGAGAGAGCTGGG - Intergenic
1172043435 20:32062295-32062317 ATTTGAAGTCAGATAGAGCTGGG - Intronic
1172461224 20:35120402-35120424 GGAGGAAGTAAGAGAGAACTGGG - Intronic
1174363724 20:50043940-50043962 ATTTTAAGAAAGAGGGAACTGGG + Intergenic
1174940138 20:54918028-54918050 ACTTGAAGTAAGACATCCCTGGG + Intergenic
1176889039 21:14292207-14292229 ACTTAGAATAAGAGAGAAATGGG - Intergenic
1178093531 21:29189633-29189655 ACTTGAAATAAGAGAAAATGTGG - Intergenic
1178420338 21:32438155-32438177 AATGGCAGAAAGAGAGAACTAGG - Intronic
1179772958 21:43637583-43637605 ACTTGACAAGAGAGAGAACTTGG + Intronic
950816859 3:15713295-15713317 ACTCAAAGTGAGAAAGAACTGGG + Intronic
952637628 3:35551007-35551029 ACTTGTAGGAACAGAGAACAAGG - Intergenic
954142258 3:48614192-48614214 CATTGAAGTAGGAGACAACTAGG + Intergenic
956583413 3:70838921-70838943 ACTTGCAGAGAGGGAGAACTTGG - Intergenic
959340762 3:105127135-105127157 AATAGAAGGAAGAGAGAAGTAGG - Intergenic
960367373 3:116789065-116789087 ACTTGTAGTAAGAGAGCCATAGG - Intronic
960547584 3:118934100-118934122 ACGTGAAGTATCAGAGAGCTAGG - Intronic
960787007 3:121384549-121384571 TCTAGAAGTAAGAGAGGACATGG + Intronic
961836446 3:129664740-129664762 ACTGAAAATAAGAGAGAGCTAGG - Intronic
961836530 3:129665726-129665748 ATTTGAAGTCAGACAAAACTGGG + Intronic
965677710 3:171215462-171215484 ATTTAAAGTATGAGTGAACTTGG - Intronic
967843524 3:194026596-194026618 CCTGGAAGTAAGAGAGAACATGG + Intergenic
970781116 4:19739263-19739285 AGATCAAGTAACAGAGAACTGGG + Intergenic
971145115 4:23968013-23968035 ACTGGAAGTAAGGAAGTACTTGG + Intergenic
971517325 4:27503429-27503451 ACTTGAAATTACAGAGATCTGGG + Intergenic
972316988 4:37935869-37935891 TCTAGAAGTAAGACAGAACATGG - Intronic
972950734 4:44319154-44319176 AATGGAAGATAGAGAGAACTTGG + Intronic
973941451 4:55915214-55915236 GCTCCAAGTCAGAGAGAACTTGG + Intergenic
974195267 4:58566103-58566125 CCCTGAAGTAGGAAAGAACTTGG - Intergenic
975576285 4:75865860-75865882 CCTTGAGGTAAGACAGACCTTGG + Intronic
975637775 4:76467444-76467466 ACTTAAAGTCAGACAGGACTGGG - Intronic
976056269 4:81071154-81071176 GCTGAAAGTAAGAGAGAACAGGG + Intergenic
976320189 4:83705304-83705326 CCCTGAAGTAAGACAGAATTGGG - Intergenic
976400263 4:84598764-84598786 AGTTGAAGTAAAAAAGAGCTGGG - Intronic
976463815 4:85344499-85344521 AGTGGAAGTAAGAGAGATCAGGG - Intergenic
976961696 4:90984317-90984339 TTTTCAAGTAATAGAGAACTTGG + Intronic
977009599 4:91620850-91620872 ACTTGAAGGAATAGAGGTCTTGG - Intergenic
977900719 4:102419248-102419270 ACATGAGGTAAGAGAGCACATGG - Intronic
978594900 4:110366945-110366967 CATAGAAGTAAGAGAGAACAGGG - Intronic
978701254 4:111649245-111649267 GGTTGAAGAAAGAGAGAAATGGG + Intergenic
979415596 4:120434469-120434491 TGTTGAAGTCAGAGAGACCTGGG + Intergenic
980208741 4:129756914-129756936 ACAGGAAGTAAGTTAGAACTAGG + Intergenic
981247091 4:142553568-142553590 ATCTGAAGGAAAAGAGAACTGGG - Intronic
981841840 4:149122143-149122165 TTTTGGAGTCAGAGAGAACTGGG - Intergenic
984401654 4:179273267-179273289 ACTTGAAGGAAATGAGTACTTGG - Intergenic
985288202 4:188358918-188358940 ACTCGAAATAAGAGAGACCAAGG - Intergenic
986764405 5:10911729-10911751 TCTTGCAGTGAGAGAGGACTTGG + Intergenic
987178299 5:15339421-15339443 ACTTGAAGTCAGATACCACTGGG - Intergenic
987972805 5:24971638-24971660 AGTTGAAGTAAGACAGAAGAAGG - Intergenic
988988218 5:36642509-36642531 ACTTGAAATAAGATAAACCTAGG - Intronic
989335172 5:40307740-40307762 AATTGAAGTAAATGAGAGCTGGG - Intergenic
990009871 5:50984156-50984178 ACTTGAAGTCAGCAAGCACTTGG + Intergenic
990700765 5:58472731-58472753 ACTTCAAGGAAGAGATAATTAGG + Intergenic
991649187 5:68834436-68834458 ACTTGACATCAGAGAGAAGTTGG + Intergenic
991996129 5:72388921-72388943 ACTTTAAATAAAATAGAACTTGG - Intergenic
993559737 5:89391291-89391313 ACTCTAAGTAACAGAAAACTGGG - Intergenic
993921063 5:93803414-93803436 AATTGAAGTAGGAGAGTTCTAGG - Intronic
993925619 5:93861969-93861991 TTTAGAAGTAATAGAGAACTTGG + Intronic
994581280 5:101645748-101645770 TCTTGAACTAGGAGTGAACTTGG - Intergenic
994662214 5:102667643-102667665 TTTTGAAGTAAGACAGACCTCGG - Intergenic
994681951 5:102899089-102899111 AGTTGAAGAAAGAGAGAGGTGGG - Intronic
996037979 5:118780118-118780140 AATGGAAGTAAGAGAGTGCTGGG + Intergenic
996753680 5:126914546-126914568 ACTTGAAGCAGGAGATAAATGGG - Intronic
999431757 5:151531104-151531126 TCTTGAAGAGAGAGAGAACTAGG - Intronic
1000729479 5:164814075-164814097 ACTGGAAGTCAGAATGAACTAGG - Intergenic
1000740223 5:164960057-164960079 ACTTGAAGTCAGAGAGAAAAAGG - Intergenic
1000808594 5:165831118-165831140 ACTTGAAGTAATAGAGAATTTGG - Intergenic
1001427465 5:171632888-171632910 GCTTGAGGTCAGAGAGACCTTGG + Intergenic
1001440860 5:171741708-171741730 CCTTGGAGTCAGAGAGAACGGGG - Intergenic
1001465279 5:171959021-171959043 GCTTGAAATCAGAGAGACCTGGG + Intronic
1002668060 5:180841442-180841464 ACTTTCAGTAAAAGGGAACTTGG - Intergenic
1003091226 6:3105275-3105297 GCTGGCAGTAAGAGAGTACTAGG - Intronic
1003108519 6:3233867-3233889 ACTGGAAGTAATAGAAAAGTTGG - Intronic
1004295539 6:14406682-14406704 ACTTCAAGTAAGAAAGAAAGCGG - Intergenic
1004483697 6:16045611-16045633 ACTTGAAGAAATAAAGAATTAGG + Intergenic
1004813541 6:19287321-19287343 ACTGGGAGTAAGAGAGTCCTGGG - Intergenic
1005080416 6:21951735-21951757 ACTTGAACTTAGAGAAAGCTGGG + Intergenic
1006016141 6:31082608-31082630 ACTTCTAGGAAGAGAGAATTAGG + Intergenic
1007183069 6:39944642-39944664 ACTTGAGGTAATATAGAATTGGG + Intergenic
1008107174 6:47451507-47451529 ACTGTAAGTAACAGAAAACTTGG - Intergenic
1009944459 6:70326498-70326520 CTTTGAAGTCAGACAGAACTAGG - Intergenic
1010689922 6:78897920-78897942 ACCTGGAGTATGATAGAACTGGG - Exonic
1011834625 6:91416497-91416519 ATTTGAAATAAGAAACAACTAGG - Intergenic
1012417855 6:99029005-99029027 CCTTGGAGTCAGACAGAACTGGG - Intergenic
1012589085 6:100957615-100957637 ACTTGAAGAAAAAGATAATTGGG - Intergenic
1013072929 6:106745290-106745312 ACATGAAGCAAGTGAGAAATGGG + Intergenic
1013565990 6:111362975-111362997 ACTGGCAGTAAGATAGAAATTGG - Intronic
1013990462 6:116249169-116249191 ACTTTAAGTATTAGAGAGCTAGG - Exonic
1013991811 6:116262672-116262694 ACTAGAAGAAATAGAGAACCAGG - Intronic
1014069254 6:117162086-117162108 ACTTGAGGTCAGAGTTAACTGGG - Intergenic
1014138608 6:117916402-117916424 AGTGGAAGTAAGAGTGAATTTGG + Intronic
1016578494 6:145600315-145600337 GTTGGAAATAAGAGAGAACTAGG - Intronic
1016890048 6:148996697-148996719 ACTTGAGGAAAGATAGATCTGGG + Intronic
1018223018 6:161600473-161600495 ACTTTAGGTAAGAGATAATTTGG + Intronic
1018310655 6:162504870-162504892 AATTGAGGAAAGACAGAACTAGG + Intronic
1018536429 6:164825471-164825493 AGTGGATGTGAGAGAGAACTTGG + Intergenic
1020670928 7:11110826-11110848 ACTTGAAGAAAGAGAGAAATCGG + Intronic
1020890755 7:13875405-13875427 ACTTGAAGTCAGGTAGACCTGGG - Intergenic
1022592472 7:31678752-31678774 ATTTGAAGTCATAGAGAACTGGG - Intergenic
1023309393 7:38868367-38868389 ATTTGAAGTAAAAAGGAACTGGG + Intronic
1023361005 7:39414931-39414953 GCTTTAGGTGAGAGAGAACTTGG - Intronic
1023737064 7:43244609-43244631 ATTTGATGTACGAGGGAACTGGG + Intronic
1024382067 7:48708501-48708523 ACAAGAAATGAGAGAGAACTGGG + Intergenic
1024747971 7:52429649-52429671 AAATGAAGGAAGAGAGAACTGGG - Intergenic
1024909877 7:54435190-54435212 ACTTGAAAAAGGAGAGATCTGGG - Intergenic
1026435223 7:70390887-70390909 CCTTGAAGTAGGAAAGAGCTTGG - Intronic
1027657725 7:80952012-80952034 ACTTGAAGAATGAGAACACTTGG - Intergenic
1028476531 7:91259742-91259764 AGTTGTAGAAAGTGAGAACTTGG - Intergenic
1029799102 7:102927044-102927066 AACTGAAGTAAGAGAGTAGTGGG + Intronic
1029954863 7:104627449-104627471 AATTGAAGTAACAGAGAAAAAGG - Intronic
1030728733 7:112958235-112958257 AGTTGAAGTAGAAAAGAACTTGG - Intergenic
1031038966 7:116818610-116818632 ACTTGAACTAAGAAGGATCTGGG + Intronic
1032143229 7:129353342-129353364 CCCTGATGTAAGAAAGAACTTGG - Intronic
1033662713 7:143413500-143413522 ACTGGGAGTCAGACAGAACTAGG - Intergenic
1033860531 7:145620272-145620294 ATTTGAAGGCAAAGAGAACTAGG - Intergenic
1034074229 7:148216413-148216435 TCTTGAAGTTAGAGAGAACTGGG - Intronic
1035867676 8:3102376-3102398 ACTTGAAAGAGAAGAGAACTAGG + Intronic
1036222891 8:6935378-6935400 ACTTTAATTAAGAGGGAAATGGG - Intergenic
1036225002 8:6950178-6950200 ACTTAAATTAAGAGAGAAATGGG - Intergenic
1038602688 8:28962740-28962762 AATTCAGGTTAGAGAGAACTAGG - Intronic
1039120513 8:34141297-34141319 ACTTGTAGTCATATAGAACTGGG - Intergenic
1039201381 8:35097134-35097156 ACTGAAAATAAAAGAGAACTTGG - Intergenic
1039263572 8:35799853-35799875 ACATGAAGGGATAGAGAACTGGG + Intergenic
1040690473 8:49931402-49931424 ACTAGAGGGAAGAGAGAAGTGGG + Intronic
1042985666 8:74580316-74580338 ATTTGAAGTGAGAGAGAGCATGG - Intergenic
1043974305 8:86567645-86567667 TCTTTAAACAAGAGAGAACTTGG - Intronic
1044458572 8:92417481-92417503 CCTTGAAGAAAGATAGAATTAGG - Intergenic
1044791790 8:95855275-95855297 ACTTGCAGTCAGAGAGAAAAAGG - Intergenic
1045609046 8:103813603-103813625 ACTTGAACAACGAGAGCACTTGG - Intronic
1046016468 8:108611163-108611185 ACATGAAGTAAATGAGAATTTGG + Intronic
1046444465 8:114298824-114298846 ATCTGAAGTTAGAGAGAACAAGG - Intergenic
1046471012 8:114674101-114674123 AGTTTAAGTAAGATAGAAATTGG + Intergenic
1047034912 8:120927107-120927129 GCTTGAAGTTAGACAGATCTGGG + Intergenic
1047162321 8:122394370-122394392 AATTGAAGAAAGAGAAAACAAGG + Intergenic
1047556052 8:125931561-125931583 AGATGAAGTCAGAGAGGACTTGG + Intergenic
1047725657 8:127681918-127681940 ACTTTTAGCAGGAGAGAACTTGG - Intergenic
1048203007 8:132392350-132392372 ATTTGAAATCAGAGAGTACTGGG - Intronic
1048669665 8:136703785-136703807 ACTTCAAGTAACAGAGAAGGAGG - Intergenic
1048730659 8:137437238-137437260 ACTGGAAGTAAGAGCTAAGTAGG + Intergenic
1050224565 9:3437547-3437569 ACTTCAAGCAAGGGGGAACTTGG + Intronic
1050444936 9:5710951-5710973 AGTTGTAGAAAGAGAGAACAGGG + Intronic
1051228761 9:14931400-14931422 AAGTGAAGTAACAGAAAACTCGG + Intergenic
1052197736 9:25737928-25737950 TCTTTAAGTTAAAGAGAACTAGG - Intergenic
1056177569 9:84050219-84050241 ACTTGGAGTCAGAGAGATCTGGG + Intergenic
1057856260 9:98603110-98603132 ATTTGGACTAAGAGAGAAATGGG + Intronic
1058273109 9:103001179-103001201 AATTCAATTAAGAGAGAATTTGG + Intronic
1058324280 9:103676101-103676123 ACTTGAAGTCAGAGAGAATAAGG + Intergenic
1058440894 9:105006004-105006026 ATTAGAACTAGGAGAGAACTTGG - Intergenic
1058533900 9:105934774-105934796 ATTTGATCTAAGAGAGACCTGGG - Intergenic
1058689446 9:107507004-107507026 AATTGAAGCCAGGGAGAACTGGG - Intergenic
1062081325 9:134625302-134625324 ACTTGGGGTCAGAGAAAACTGGG - Intergenic
1186081082 X:5932573-5932595 ATAAGAAGTAAAAGAGAACTTGG + Intronic
1187067749 X:15856516-15856538 TCTTGTAGTAAGAGAGAAATGGG - Intergenic
1187598912 X:20805236-20805258 ACTTGAAGTAAGGGGAAACAGGG + Intergenic
1187981102 X:24758532-24758554 AGTTGATGTAAGAGACAGCTGGG + Intronic
1189973674 X:46441989-46442011 CCTGGAAGTAAGAAAGAACGTGG - Intergenic
1191781458 X:64872266-64872288 ACTTGGTGAAAGAGAGAATTAGG - Intergenic
1191834171 X:65446244-65446266 ACTTGAGGAAAGAGAGAAAAAGG - Intronic
1191933257 X:66397072-66397094 AGTAGAAGAAAGAGAGAAATGGG + Intergenic
1192847578 X:74922274-74922296 ACTTGAAGTAAAACAGAAAGTGG + Intronic
1193765200 X:85519903-85519925 ACATGAACTAGGAGAGAACTAGG - Intergenic
1197226125 X:123958640-123958662 ACTTGAAGTAATAGAAAAATTGG - Intergenic
1197523741 X:127534248-127534270 ATTTGAGGTCAGACAGAACTGGG - Intergenic
1198403984 X:136294483-136294505 ACTTGAAGAAAGAGCGTTCTGGG - Intergenic
1198500025 X:137234951-137234973 AGTCGAAGTGAGAGAGAAGTTGG - Intergenic
1198526598 X:137507694-137507716 CCTTGTACTAAGTGAGAACTAGG + Intergenic
1200274082 X:154715592-154715614 AATGGTAGAAAGAGAGAACTTGG - Intronic
1201456864 Y:14177815-14177837 ACTAGATGTGAGAGAGTACTTGG + Intergenic