ID: 1065493434

View in Genome Browser
Species Human (GRCh38)
Location 10:26305596-26305618
Sequence CTGGTGAGGCTACGTGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065493426_1065493434 25 Left 1065493426 10:26305548-26305570 CCAATTCTTAATTTCATAGCAAA No data
Right 1065493434 10:26305596-26305618 CTGGTGAGGCTACGTGTTTCAGG No data
1065493429_1065493434 1 Left 1065493429 10:26305572-26305594 CCCATGGCCTGTGGCTCAGAAAA No data
Right 1065493434 10:26305596-26305618 CTGGTGAGGCTACGTGTTTCAGG No data
1065493432_1065493434 -6 Left 1065493432 10:26305579-26305601 CCTGTGGCTCAGAAAATCTGGTG No data
Right 1065493434 10:26305596-26305618 CTGGTGAGGCTACGTGTTTCAGG No data
1065493430_1065493434 0 Left 1065493430 10:26305573-26305595 CCATGGCCTGTGGCTCAGAAAAT No data
Right 1065493434 10:26305596-26305618 CTGGTGAGGCTACGTGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065493434 Original CRISPR CTGGTGAGGCTACGTGTTTC AGG Intergenic
No off target data available for this crispr