ID: 1065493753

View in Genome Browser
Species Human (GRCh38)
Location 10:26308344-26308366
Sequence GTCTCCCACGTGGTGTGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065493746_1065493753 22 Left 1065493746 10:26308299-26308321 CCTAGCCTCTGAATTTTCAGGGA No data
Right 1065493753 10:26308344-26308366 GTCTCCCACGTGGTGTGGCCGGG No data
1065493744_1065493753 23 Left 1065493744 10:26308298-26308320 CCCTAGCCTCTGAATTTTCAGGG No data
Right 1065493753 10:26308344-26308366 GTCTCCCACGTGGTGTGGCCGGG No data
1065493747_1065493753 17 Left 1065493747 10:26308304-26308326 CCTCTGAATTTTCAGGGATATGG No data
Right 1065493753 10:26308344-26308366 GTCTCCCACGTGGTGTGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065493753 Original CRISPR GTCTCCCACGTGGTGTGGCC GGG Intergenic
No off target data available for this crispr