ID: 1065496570

View in Genome Browser
Species Human (GRCh38)
Location 10:26335410-26335432
Sequence GTTTGGCAGCACCATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065496570_1065496576 13 Left 1065496570 10:26335410-26335432 CCTACAGCATGGTGCTGCCAAAC No data
Right 1065496576 10:26335446-26335468 TGGCATCTCTTTGCCCGGGATGG No data
1065496570_1065496571 -7 Left 1065496570 10:26335410-26335432 CCTACAGCATGGTGCTGCCAAAC No data
Right 1065496571 10:26335426-26335448 GCCAAACTGCCTCTCTGATTTGG No data
1065496570_1065496574 8 Left 1065496570 10:26335410-26335432 CCTACAGCATGGTGCTGCCAAAC No data
Right 1065496574 10:26335441-26335463 TGATTTGGCATCTCTTTGCCCGG No data
1065496570_1065496575 9 Left 1065496570 10:26335410-26335432 CCTACAGCATGGTGCTGCCAAAC No data
Right 1065496575 10:26335442-26335464 GATTTGGCATCTCTTTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065496570 Original CRISPR GTTTGGCAGCACCATGCTGT AGG (reversed) Intergenic
No off target data available for this crispr