ID: 1065498033

View in Genome Browser
Species Human (GRCh38)
Location 10:26350006-26350028
Sequence TCATGGGCTTTGAGAGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065498028_1065498033 -8 Left 1065498028 10:26349991-26350013 CCCACCTCTCAACCCTCATGGGC No data
Right 1065498033 10:26350006-26350028 TCATGGGCTTTGAGAGCCACAGG No data
1065498029_1065498033 -9 Left 1065498029 10:26349992-26350014 CCACCTCTCAACCCTCATGGGCT No data
Right 1065498033 10:26350006-26350028 TCATGGGCTTTGAGAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065498033 Original CRISPR TCATGGGCTTTGAGAGCCAC AGG Intergenic
No off target data available for this crispr