ID: 1065498335

View in Genome Browser
Species Human (GRCh38)
Location 10:26352931-26352953
Sequence TCAGAACAGATCCCTTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065498333_1065498335 -9 Left 1065498333 10:26352917-26352939 CCATTCCAGAAGATTCAGAACAG No data
Right 1065498335 10:26352931-26352953 TCAGAACAGATCCCTTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065498335 Original CRISPR TCAGAACAGATCCCTTGTTC AGG Intergenic
No off target data available for this crispr