ID: 1065499760

View in Genome Browser
Species Human (GRCh38)
Location 10:26367970-26367992
Sequence TCCTTACCACAGAAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065499757_1065499760 -4 Left 1065499757 10:26367951-26367973 CCAGGTATTGGGAAAGACTTCCT No data
Right 1065499760 10:26367970-26367992 TCCTTACCACAGAAGGTGAAGGG No data
1065499756_1065499760 3 Left 1065499756 10:26367944-26367966 CCAGCAGCCAGGTATTGGGAAAG No data
Right 1065499760 10:26367970-26367992 TCCTTACCACAGAAGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065499760 Original CRISPR TCCTTACCACAGAAGGTGAA GGG Intergenic
No off target data available for this crispr