ID: 1065507091

View in Genome Browser
Species Human (GRCh38)
Location 10:26439455-26439477
Sequence CAAATTATGAAACTTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 213}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065507091_1065507093 -1 Left 1065507091 10:26439455-26439477 CCAGGCACAAGTTTCATAATTTG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 1065507093 10:26439477-26439499 GGCTTGAAATGAATATCCAGAGG No data
1065507091_1065507094 0 Left 1065507091 10:26439455-26439477 CCAGGCACAAGTTTCATAATTTG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 1065507094 10:26439478-26439500 GCTTGAAATGAATATCCAGAGGG No data
1065507091_1065507096 15 Left 1065507091 10:26439455-26439477 CCAGGCACAAGTTTCATAATTTG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 1065507096 10:26439493-26439515 CCAGAGGGCCTTTTACAGAATGG No data
1065507091_1065507097 18 Left 1065507091 10:26439455-26439477 CCAGGCACAAGTTTCATAATTTG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 1065507097 10:26439496-26439518 GAGGGCCTTTTACAGAATGGAGG No data
1065507091_1065507099 30 Left 1065507091 10:26439455-26439477 CCAGGCACAAGTTTCATAATTTG 0: 1
1: 0
2: 1
3: 16
4: 213
Right 1065507099 10:26439508-26439530 CAGAATGGAGGAAACTAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065507091 Original CRISPR CAAATTATGAAACTTGTGCC TGG (reversed) Intronic
900865618 1:5266704-5266726 CAAGCTTTGAAGCTTGTGCCTGG - Intergenic
902418936 1:16262316-16262338 CAAAGTATGAAATATGAGCCAGG - Intronic
902855675 1:19202772-19202794 CAATTGATGAAACATGGGCCGGG + Intronic
903784455 1:25849013-25849035 CAAATTATGAAACCTGAGAATGG + Intronic
905338892 1:37264837-37264859 AAAATTCTGAATCTAGTGCCTGG + Intergenic
906431995 1:45762512-45762534 CAACTTCTGTAACTTGTGACCGG + Intergenic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
908066718 1:60413996-60414018 AAAAATATGCAATTTGTGCCAGG - Intergenic
908558412 1:65281220-65281242 TAAAATTTGAAACTTGAGCCGGG - Intronic
909728620 1:78867088-78867110 CCAATTATCAAACCTGTGACTGG - Intergenic
909814807 1:79978285-79978307 CAAATTATGACAATTGTGCTTGG + Intergenic
910486231 1:87717363-87717385 TAAATTCTGAAACTTGTGTTTGG - Intergenic
911268953 1:95777244-95777266 CAAATTATGAAATTAGTCTCGGG - Intergenic
913209782 1:116572565-116572587 CAAATGAGGAAACTGATGCCTGG + Intergenic
915411203 1:155702172-155702194 AAAATTAGAAAACTTGGGCCAGG + Intronic
916553207 1:165869945-165869967 CAAAATTTAAAACTTTTGCCAGG - Intronic
917656932 1:177135698-177135720 CAAATGATGAAACTGAGGCCTGG - Intronic
919134404 1:193489852-193489874 CAAATTATCAAACTTGGGGGGGG + Intergenic
919450556 1:197767961-197767983 GAAATGATGAAACTTGCGCAGGG - Intronic
920205561 1:204288486-204288508 CACATTATGAAATATTTGCCTGG + Intronic
920660411 1:207910260-207910282 CAAGTTTTGAAATTTGTGCAGGG + Intronic
922309496 1:224374688-224374710 CAAGTTAAGAAACTTGCCCCAGG - Intronic
924795276 1:247288298-247288320 AACCTTATGAAGCTTGTGCCAGG - Intergenic
1062866913 10:863522-863544 CAAAAGATGAAACCTGGGCCGGG - Intronic
1065507091 10:26439455-26439477 CAAATTATGAAACTTGTGCCTGG - Intronic
1066249799 10:33622007-33622029 CATATTATGTAACCTCTGCCAGG - Intergenic
1066710515 10:38228413-38228435 CAAATTATTAAACTTGAGCAAGG + Intergenic
1066979498 10:42399034-42399056 CGAATTATTAAACTTGAGCAAGG - Intergenic
1067994175 10:51251220-51251242 CAATTTATGAAACAGGTGCCTGG - Intronic
1069118176 10:64534503-64534525 AAAATTAGAAATCTTGTGCCTGG - Intergenic
1070635249 10:78120401-78120423 GAAAGTGTGAAACTTGTGCATGG + Intergenic
1071368950 10:84931169-84931191 CAAATTTTGAAAGTTTTGGCTGG - Intergenic
1072454649 10:95565077-95565099 TAAATTATGTAACTTGTCCTGGG + Intergenic
1072634790 10:97170926-97170948 GAAATTGTGAAGCTGGTGCCAGG - Intronic
1074118103 10:110472906-110472928 AAAATTATGAGATTTTTGCCAGG - Intergenic
1077625698 11:3769450-3769472 AAAATTATGAAACATTAGCCAGG + Intronic
1078324114 11:10365354-10365376 CAAATTATCAAACTTGGGGAGGG + Intronic
1079531947 11:21464840-21464862 TAAATTATTAAACTGGTGTCTGG - Intronic
1080313646 11:30923911-30923933 CAAAATAAGAAATTTTTGCCTGG - Intronic
1080320604 11:31004766-31004788 GAAATTAAGAAACTTGTCCATGG - Intronic
1082186251 11:49185479-49185501 CTTATTTTGAAACTTGGGCCTGG - Intronic
1083356963 11:62073919-62073941 GAAATTATGAAGCTTTGGCCTGG - Intergenic
1086044987 11:82522208-82522230 CTAATTATGCAACTTGGGGCAGG - Intergenic
1086680078 11:89659892-89659914 CTTATTTTGAAACTTGGGCCTGG + Intergenic
1087354828 11:97079333-97079355 CTCATTATGAAACTTCTGCCTGG - Intergenic
1087642911 11:100774751-100774773 CTAATTATGAAAGTTGTTCTGGG + Intronic
1095713237 12:45312991-45313013 CAAATAATGAAAATTTTGACAGG + Intronic
1095828246 12:46553430-46553452 CAAGTTATGAAACTATTGCAGGG - Intergenic
1098651791 12:72979767-72979789 CAAACTAGGAATCTTCTGCCAGG + Intergenic
1100427032 12:94497146-94497168 CAAATTATCAAACCTTGGCCAGG - Intergenic
1101052356 12:100876145-100876167 CAAATTATGTAGCTTGTCCTGGG + Intronic
1103484260 12:121272513-121272535 CCAATTATGAAAGTTTTTCCTGG + Intronic
1104694496 12:130852978-130853000 CAAATTATCAAACTTGAGGAGGG - Intergenic
1105371958 13:19809819-19809841 GAAATAATAAAACTTGGGCCAGG - Intergenic
1106075208 13:26454369-26454391 CAAACTGTGAAACTAGTGCAAGG + Intergenic
1107037649 13:35917879-35917901 CAAATTCTGAAATGTGTGTCAGG - Intronic
1107937767 13:45359458-45359480 AAAATCAAGAAACTTGGGCCGGG - Intergenic
1108968014 13:56336979-56337001 AAAATTATCAAATTTGAGCCAGG - Intergenic
1109782085 13:67125054-67125076 CAACTCATGAAACTTCTGACTGG + Intronic
1110233436 13:73191227-73191249 CAAGTTATGTAACTGATGCCTGG - Intergenic
1112539124 13:100289850-100289872 CAAATAATGAAAGATGTGTCTGG - Intronic
1112944207 13:104906380-104906402 CACATTAAGAAACTTCTGCATGG - Intergenic
1114712403 14:24792049-24792071 TAAACTATGAAACTTGGCCCAGG - Intergenic
1117352906 14:54898917-54898939 AAAATTAAGAAAATTGGGCCAGG - Intronic
1117668109 14:58078254-58078276 CAGATTATTAAACTAGTGCAGGG - Intronic
1117961014 14:61161520-61161542 CAAATTATGTAAATCATGCCTGG - Intergenic
1119959368 14:78837053-78837075 TTAATTAAGAAACTTTTGCCTGG + Intronic
1124588790 15:31035439-31035461 CAAATTATGCATGTTGGGCCAGG - Intronic
1125815792 15:42582968-42582990 GAAATTATGTAACTTGTCCAAGG - Intronic
1126444014 15:48721632-48721654 CACATTATGAAAGCTGAGCCTGG + Intronic
1129133970 15:73529554-73529576 CATGTTATGAAAATTGTGACTGG + Intronic
1129301277 15:74626996-74627018 CAAATTATGTAGCTGGTGCAGGG + Intronic
1129880351 15:79002676-79002698 GAAATTATGAAATTTCTGGCAGG + Intronic
1130371545 15:83288817-83288839 GAAATTGTGACACCTGTGCCAGG - Intergenic
1130687050 15:86047742-86047764 CAAATTAAAAAACTTATGCATGG + Intergenic
1131149351 15:90037176-90037198 AAAATTATCAAAGTTGTTCCAGG + Intronic
1134314208 16:13103301-13103323 TAAATCATGAAACTCATGCCAGG - Intronic
1135879975 16:26245919-26245941 AAAATTATAAAACTTATTCCTGG + Intergenic
1137790030 16:51167177-51167199 CAAAATATTAAACCTGTCCCTGG + Intergenic
1138183640 16:54960237-54960259 GAAGTTAAGCAACTTGTGCCAGG + Intergenic
1140498749 16:75413785-75413807 AAAATTATGAAAATTCTGACAGG - Intronic
1147349417 17:39828522-39828544 CAAATTATTAAACATGTGGAGGG + Intronic
1147537476 17:41330048-41330070 CAAATTAAGAAATTTAGGCCAGG + Intergenic
1147606069 17:41774302-41774324 GAAATTATAAAACATCTGCCAGG - Intronic
1149790798 17:59475175-59475197 AAAATTATGACATTTGTGGCCGG + Intergenic
1149947502 17:60946352-60946374 AAAATTATGAAACTTTTACAAGG + Intronic
1151847868 17:76670733-76670755 AAAATTAAGAAAATTGTTCCAGG - Intergenic
1153100036 18:1457224-1457246 TTAATTATGAATCTTTTGCCAGG - Intergenic
1155076366 18:22359520-22359542 AACATTATGATATTTGTGCCTGG + Intergenic
1157032954 18:43935453-43935475 AAAAGTATGAAGCTTGTTCCTGG - Intergenic
1157944743 18:51966577-51966599 CTAATGAGGAAACTTGTGTCTGG + Intergenic
1157952570 18:52056083-52056105 CAAATAATGAATCTTGTGTTTGG - Intergenic
1158130443 18:54147109-54147131 CAAATTATCAAACTTGAGGGTGG + Intergenic
1158157353 18:54441315-54441337 CAAATAATGACAATTGTTCCAGG + Intergenic
1161317968 19:3627077-3627099 CAAACTAGGAACCTTGTGCAGGG + Intergenic
1162188442 19:8925772-8925794 AAAATTATTAAACCTGGGCCGGG + Intronic
1162629641 19:11917021-11917043 CAAATTATGGAACTTGAGTAAGG + Intergenic
1162634694 19:11958251-11958273 CAAATTATGGAACTTGAGTAAGG + Intronic
1164015339 19:21251875-21251897 AGAATTAAGAAACTTATGCCAGG + Intronic
1164136159 19:22418257-22418279 CAAATTATGAAACTTGAGGGAGG - Intronic
1164823035 19:31264779-31264801 CACATTTTGCAACCTGTGCCAGG + Intergenic
1168341190 19:55624167-55624189 CAAATTATGCAAATTATCCCTGG + Intronic
1168471697 19:56645572-56645594 CAGGTTCTGAATCTTGTGCCTGG + Exonic
925602357 2:5621742-5621764 AAAATTCTAAAACTTGGGCCGGG + Intergenic
927755180 2:25702519-25702541 CAAATGATGAAACTTCTACTGGG - Intergenic
929773796 2:44915184-44915206 CAAATGAGGAAACTGGGGCCTGG + Intergenic
930953461 2:57173817-57173839 CAAATGAGGAAAATTGTGGCTGG - Intergenic
931734923 2:65185239-65185261 GAAGTTAGGTAACTTGTGCCAGG + Intergenic
932607263 2:73173735-73173757 CAAATTATGAAGATTCGGCCGGG - Intergenic
932852769 2:75202038-75202060 CAAATGGTGGAACTGGTGCCAGG + Intergenic
933140548 2:78787550-78787572 TAAATTATGAATCTTGTGATTGG + Intergenic
933191179 2:79335849-79335871 CAACTTAGGAAACTTGCACCTGG + Intronic
934556869 2:95291711-95291733 CAAAGCATGAAACATTTGCCAGG + Intergenic
935102407 2:100009528-100009550 CTAACTATGAAAAATGTGCCAGG + Intronic
936472728 2:112813125-112813147 ACATTTATTAAACTTGTGCCAGG + Intergenic
938917631 2:135958864-135958886 CAAATTATAAACCTTGTCACTGG - Intronic
939467891 2:142581720-142581742 CAAGTTAAGAAACTTTTGCCAGG - Intergenic
939949338 2:148450236-148450258 GAAATTTTAAAACTTGTGCAAGG + Intronic
940557017 2:155241903-155241925 CAAATAATGGAACCTGTGACAGG + Intergenic
942040600 2:172058335-172058357 GAAATGAAGAAACTTGTGCAGGG + Intronic
945273228 2:207962528-207962550 CAAATTATCAAACCTGAGGCGGG + Intronic
946812304 2:223538890-223538912 TAAATCATGAAACCCGTGCCAGG + Intergenic
1169031401 20:2410503-2410525 CAAATTATGAAACCTAAGGCTGG + Intronic
1169434902 20:5577906-5577928 GAAATTATAAAGCTTGTGCCAGG - Intronic
1170115713 20:12857067-12857089 CATAGTGTGAAACATGTGCCAGG - Intergenic
1171293979 20:24000547-24000569 CAAATCAAGAAAGATGTGCCAGG - Intergenic
1172219643 20:33264681-33264703 CAAAATATGAAAAATGAGCCAGG + Intergenic
1173306169 20:41852162-41852184 CAAATTATCAAACCTGGGGCAGG - Intergenic
1173608312 20:44348056-44348078 CAAACTAGAAAACTTGAGCCTGG - Intronic
1175095002 20:56534297-56534319 CAAAATATGAAACTTCTGTAAGG + Intronic
1177239677 21:18440995-18441017 AGGATTATGAAAGTTGTGCCAGG + Intronic
1178125295 21:29509562-29509584 CAAATTTTGTAACCTGTTCCTGG + Intronic
1184836629 22:47027619-47027641 AAAATTATAAAACTTCTGCAAGG + Intronic
950064466 3:10100772-10100794 AAAATTATGCAAATTGGGCCGGG + Intronic
950123559 3:10497634-10497656 GAAATTAAGAAACTTGTGCTGGG + Intronic
951188490 3:19741807-19741829 TAAATTATTAAACTTGGGCCAGG + Intergenic
952203751 3:31158303-31158325 CAACTGAGGAAACTTGTACCTGG - Intergenic
956958551 3:74370987-74371009 CAAATTATGAAGCTTGCCCGGGG + Intronic
957689197 3:83545547-83545569 CAAAATATGAAACTTTGGCTGGG - Intergenic
958071072 3:88612404-88612426 CACATTTTAAAACTTGTCCCTGG + Intergenic
958685859 3:97392990-97393012 CAAATAATAATACTTTTGCCTGG + Intronic
959257496 3:104033168-104033190 CACATTATGAAATTTTTGGCTGG - Intergenic
960472315 3:118081996-118082018 CTAATTATAAAACTGGTGTCTGG + Intergenic
960521403 3:118659670-118659692 AAAATTAAGGAACTTGGGCCGGG + Intergenic
960789086 3:121406967-121406989 AAGATTATGAAAGTTGGGCCAGG - Intronic
961018397 3:123484412-123484434 CAAATTATTAAACATGTTGCTGG + Intergenic
964814477 3:160701879-160701901 CAAAGTTTCAGACTTGTGCCAGG + Intergenic
965157857 3:165087663-165087685 AAAAGTATAAAACTTATGCCTGG - Intergenic
967321332 3:188197970-188197992 CGAATTATGTAACTTGTGCAAGG - Intronic
968333137 3:197888780-197888802 GAAAATATCTAACTTGTGCCTGG - Intergenic
971089699 4:23326935-23326957 CAAATTATGAAAAGTGTTCTAGG + Intergenic
971464088 4:26936186-26936208 TAAATTGTGAAACTTCTACCTGG + Intronic
975142135 4:70928949-70928971 GAAAATAGGAAACTTGTGCCTGG - Intronic
975276745 4:72511159-72511181 CAAATTATGAAACTATTACAAGG + Intronic
975369088 4:73563175-73563197 CAAATTCTGAAACTACTGCAAGG - Intergenic
976836426 4:89379929-89379951 CAAATGATGACACTTCTGCTGGG - Intergenic
978473507 4:109097956-109097978 TAAAAAATGAAATTTGTGCCTGG - Intronic
978886905 4:113775298-113775320 CAAATTATCAAACCTGTGGAGGG - Intergenic
980316393 4:131207200-131207222 TAAAATATGAAATTTGTGACTGG + Intergenic
980763145 4:137263493-137263515 GAAATTAAGAAGCTTGTTCCAGG - Intergenic
981232011 4:142367724-142367746 CAAAGTTTGAGAATTGTGCCAGG + Intronic
981334146 4:143549941-143549963 GAAATCATGAAACTTGTGGATGG + Intronic
983294254 4:165845690-165845712 TATATTTTGAAACTTTTGCCTGG - Intergenic
986883574 5:12205820-12205842 TCAATTATGAAACTTGTTACTGG + Intergenic
987304461 5:16624640-16624662 AAAATTATTGAACTTGAGCCAGG - Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
988704610 5:33712394-33712416 CAAGTAATGAAACTTGGGCAGGG + Intronic
991269153 5:64758785-64758807 CAAACTATGAAACTTTTTCTTGG + Intronic
991981156 5:72232213-72232235 CATATTTTGAAACTTGAGCTAGG - Intronic
993318241 5:86438696-86438718 CAAATAATGAATTTTGTGCAAGG - Intergenic
993687896 5:90962752-90962774 TAAATCATGAAAGTTGTTCCAGG - Intronic
995164204 5:109019055-109019077 AAAAATATTACACTTGTGCCTGG - Intronic
997154802 5:131543510-131543532 CAAATTCTGAAACATGTGAAAGG + Intronic
997557221 5:134810708-134810730 TAAAATATTAAACTTGGGCCGGG + Intronic
998705910 5:144760363-144760385 GAAATTATGTAACTTGTTCAAGG + Intergenic
998722493 5:144970208-144970230 CAATTTATTAAATTTATGCCAGG - Intergenic
1000440513 5:161257757-161257779 CAAATTATACAACTAGTGCATGG - Intergenic
1000733656 5:164870133-164870155 CAAATTATGGAACTGAGGCCCGG + Intergenic
1001630227 5:173169427-173169449 AAAATTATGAAATTTCTGCCAGG - Intergenic
1005720311 6:28595036-28595058 CAAGTTATGAAATGTGTACCTGG + Intronic
1005889005 6:30121039-30121061 CACATTAAGAACTTTGTGCCGGG - Intergenic
1009530737 6:64811064-64811086 CAAATTATGAGATTTGTTCATGG - Intronic
1010363813 6:75026698-75026720 AAAATTTTTAATCTTGTGCCTGG - Intergenic
1010696441 6:78980154-78980176 AAATTTATGAAAATTGTGGCAGG - Intronic
1011042219 6:83042201-83042223 CAAATTTTGCATCTTGGGCCGGG - Intronic
1012189571 6:96262685-96262707 CAAGTTATGAAACTACTACCAGG + Intergenic
1013249030 6:108315884-108315906 CAAAAAATGAAACGTGAGCCAGG + Intronic
1018337837 6:162814580-162814602 CAAATGATGGAACTGGTGGCTGG + Intronic
1020401233 7:7779937-7779959 TATATTAAGAAACTTGGGCCGGG - Intronic
1021213725 7:17889306-17889328 CAAATCATAAAACTTGTGCCAGG + Intronic
1021684820 7:23174230-23174252 CAAATTAAACAACTTGTGACTGG - Exonic
1023268928 7:38438466-38438488 CTAATTAAGAAACTTGGGTCTGG - Intronic
1031454372 7:121961245-121961267 CAGATTATGATCCATGTGCCTGG - Intronic
1031639489 7:124144012-124144034 GAAGTTTTGAAACTTCTGCCTGG + Intergenic
1031744104 7:125471551-125471573 CAAATTAAGAGACTTCTGCAAGG + Intergenic
1032647019 7:133835929-133835951 CCAATTATAGACCTTGTGCCTGG + Intronic
1033423121 7:141220022-141220044 AAAATTATGAATGTTGGGCCAGG + Intronic
1034122572 7:148640817-148640839 CATATTAAGAAACTTGAGGCTGG - Intergenic
1037266443 8:17066840-17066862 CAAAATATGAAACTGTGGCCAGG - Intronic
1037736618 8:21572069-21572091 CAAATTATGAAACCTGAGGATGG + Intergenic
1042013516 8:64279393-64279415 CATCTTCTGAAACTTGTGACTGG - Intergenic
1042585033 8:70327264-70327286 CAAATTAAGTAAAGTGTGCCTGG + Intronic
1044980911 8:97716002-97716024 GCAATTATGTAACTTGTGCAAGG - Intronic
1045869065 8:106904725-106904747 CAAATTATGGAACTTGAGAAGGG - Intergenic
1046010502 8:108540772-108540794 GAAATTATGAAAGATGTGTCTGG - Intergenic
1046705519 8:117446420-117446442 CAAATGAAGAAACTTGTTCAAGG + Intergenic
1048556490 8:135482878-135482900 CACCTTATTAAACTAGTGCCTGG + Intronic
1050511937 9:6405549-6405571 AAAATTATGAAATATGGGCCAGG - Intergenic
1050514578 9:6429780-6429802 CAAATTAAGTAACTTGTTCATGG + Intronic
1052589957 9:30479283-30479305 CAAATTATCTAACTGGAGCCGGG + Intergenic
1053169497 9:35868703-35868725 CTATTTAAGAAACTTGTGCAGGG + Intergenic
1056411832 9:86336138-86336160 CAACTTATCCAACTTGTGCCAGG + Intronic
1057616039 9:96591084-96591106 CAAACTTTGAAACTTCTGCTCGG - Intronic
1058524414 9:105842757-105842779 AAAATTATAAAATTTGGGCCAGG + Intergenic
1059156425 9:111992763-111992785 AAAAATATGAAACTTTTGCCAGG + Intergenic
1060900606 9:127254244-127254266 CAAACTTTGAAACTTTTGCATGG + Intronic
1061266778 9:129510598-129510620 CAAAAGATGTAACCTGTGCCAGG + Intergenic
1185863047 X:3596897-3596919 CAATTTATAAAACTTGAGCTAGG - Intergenic
1186162047 X:6787614-6787636 GAAATTGTGAAAAATGTGCCAGG - Intergenic
1186273829 X:7918914-7918936 CAAACTGTGAAACCTATGCCTGG - Intronic
1187654964 X:21461644-21461666 CAACCTATGAAACTACTGCCAGG - Intronic
1188531659 X:31147719-31147741 CAAAATTTGAAGCTTTTGCCTGG + Intronic
1188924064 X:36017495-36017517 CAAACTATGAAACTTCTACAAGG - Intergenic
1192324278 X:70119006-70119028 CAAATTATGAGACTTGTAGAAGG + Intergenic
1194083201 X:89493520-89493542 CAAACTATGAAACTCCTGCAAGG - Intergenic
1197429004 X:126336251-126336273 CAACTTATTAAATTGGTGCCTGG + Intergenic
1199064183 X:143394610-143394632 AAAATTAAGCAACTTGTTCCTGG - Intergenic
1199697823 X:150355860-150355882 CAAATTAGGAAACTTGCCCCAGG + Intergenic
1200435852 Y:3149394-3149416 CAAACTATGAAACTCCTGCAAGG - Intergenic
1200800449 Y:7382360-7382382 CAATTTATAAAACTTGAGCTAGG + Intergenic
1202071031 Y:20991693-20991715 CAAGTTCTGAAATTTATGCCTGG - Intergenic