ID: 1065507151

View in Genome Browser
Species Human (GRCh38)
Location 10:26439915-26439937
Sequence GGCCTCACTGGAATAATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065507143_1065507151 13 Left 1065507143 10:26439879-26439901 CCTTTTTCATAAACCTAGAGCAG No data
Right 1065507151 10:26439915-26439937 GGCCTCACTGGAATAATGGGTGG No data
1065507144_1065507151 0 Left 1065507144 10:26439892-26439914 CCTAGAGCAGCGATTTTCCCTCT No data
Right 1065507151 10:26439915-26439937 GGCCTCACTGGAATAATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065507151 Original CRISPR GGCCTCACTGGAATAATGGG TGG Intronic