ID: 1065508163

View in Genome Browser
Species Human (GRCh38)
Location 10:26450620-26450642
Sequence CTAGTTTTCCACAGCCATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065508163_1065508164 14 Left 1065508163 10:26450620-26450642 CCACTATGGCTGTGGAAAACTAG 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1065508164 10:26450657-26450679 TTCCCTGACCCCTGCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065508163 Original CRISPR CTAGTTTTCCACAGCCATAG TGG (reversed) Intronic
900281854 1:1874906-1874928 CAATTTTTCCACAGACAGAGGGG + Intronic
907614212 1:55907332-55907354 CAATTTTTCCACAGACAGAGTGG - Intergenic
909851165 1:80465889-80465911 AAAATTTTCTACAGCCATAGTGG + Intergenic
911989472 1:104674790-104674812 CTATTTTTGGACAGCTATAGTGG - Intergenic
916828932 1:168471299-168471321 CTAGTTTTGCTCTGCCTTAGTGG - Intergenic
917135984 1:171788505-171788527 TTATATTTCAACAGCCATAGGGG + Intronic
917136515 1:171793162-171793184 CTAGTTTGCCACACCCTTACTGG - Intronic
918422689 1:184380124-184380146 CTAGTTTTCAAAAGCTATACTGG - Intergenic
1062872891 10:922051-922073 CAATTTTTCCACAGACAGAGCGG + Intronic
1064042125 10:11976017-11976039 CTAGATTTCAAGAGCCCTAGAGG - Intronic
1065508163 10:26450620-26450642 CTAGTTTTCCACAGCCATAGTGG - Intronic
1067848587 10:49740979-49741001 CTGGTTTTCCACAGCCTTCTTGG - Intronic
1071938807 10:90563440-90563462 CTAGTTTTCTACAGCACTATAGG - Intergenic
1073946875 10:108761087-108761109 CTAAATTTCCACATCCATACTGG + Intergenic
1078228654 11:9418019-9418041 CTAGTTTTCTAGAGATATAGGGG + Intronic
1078526460 11:12105177-12105199 CTAGTTCTCCATACCCTTAGTGG + Intronic
1081733935 11:45390782-45390804 CTTGTTCTTCACAGCCATGGTGG - Intergenic
1085249737 11:75135073-75135095 CCAGTTTTCCACAGGCAGACTGG + Intronic
1088421198 11:109649152-109649174 CTAGTATGCCACAGGCATTGGGG - Intergenic
1104697366 12:130873029-130873051 CTAGTGTTCCACACCAACAGAGG + Exonic
1107405107 13:40104995-40105017 TTAGTTTTCCAGAGCTAGAGAGG - Intergenic
1108555713 13:51589868-51589890 CTAATTTTCCACAATCATACAGG - Intronic
1110939029 13:81326259-81326281 TTAGAATTCCACTGCCATAGAGG + Intergenic
1111359351 13:87154574-87154596 CAATTTTTCCACAGACAAAGGGG + Intergenic
1119967013 14:78928080-78928102 CCAGTTGTCCACAGCAATAGTGG + Intronic
1121753904 14:96386013-96386035 CTAGATTTGCACAGTAATAGAGG + Exonic
1202906508 14_GL000194v1_random:76667-76689 CCAGGTTTCCACAGCCTGAGTGG + Intergenic
1126582440 15:50253651-50253673 CTAGTGTTGCACAGACCTAGGGG + Exonic
1128042406 15:64586655-64586677 CAATTTTTCCACAGACAGAGGGG - Intronic
1130327735 15:82895211-82895233 CTAGTAATCCACAGCCCCAGAGG - Intronic
1136656812 16:31713983-31714005 TTCGTTTTCTACAGCCAAAGTGG - Intronic
1139070395 16:63373930-63373952 CTAGTCTTCCAAATCCCTAGTGG + Intergenic
1147530391 17:41271149-41271171 ATTGTTTTCCACAGTCATTGTGG - Intergenic
1148656996 17:49292291-49292313 CTAGTCCTTCACAGCCAGAGTGG - Intronic
1152684964 17:81689419-81689441 CTAGTTCTCCACGGCCACAATGG - Intronic
1156419110 18:36931492-36931514 CAATTTTTCCACAGACATTGTGG - Intronic
1156548468 18:37989870-37989892 CTGGTTGTCCACAGCCCTTGGGG - Intergenic
1158110537 18:53935802-53935824 CCAGTTTTCCACAGCAACACTGG + Intergenic
1162852663 19:13442783-13442805 CTGTTTTCCCCCAGCCATAGTGG + Intronic
1166600220 19:44087456-44087478 CTAGTGTTCCACAGCACTAAAGG - Exonic
1166933525 19:46316870-46316892 CCAGTTTTCTAAAGCCTTAGGGG + Intronic
1167255376 19:48424744-48424766 CAAGTGATCCACAGCCCTAGTGG + Intronic
1202649694 1_KI270706v1_random:169286-169308 CCAGGTTTCCACAGCCTGAGTGG + Intergenic
926243893 2:11107937-11107959 CTCGGTTTCCACAGCCATCCGGG + Intergenic
928783393 2:34852426-34852448 CTAGTTTTCTACAGCACTATAGG - Intergenic
930920702 2:56750165-56750187 CTAGTTTTTCCAATCCATAGTGG - Intergenic
932595027 2:73088294-73088316 CCAGGTTGCCACACCCATAGTGG - Exonic
936025126 2:109025887-109025909 CTAGTTTTTCACAGAGATGGGGG + Intergenic
937218199 2:120326020-120326042 CTACTTTTCCTCAGCCATCAAGG - Intergenic
942671776 2:178383649-178383671 CATGTTTCCCACAGCCATATGGG - Intronic
1171881676 20:30621981-30622003 CCAGGTTTCCACAGCCTGAGTGG - Intergenic
1172289006 20:33761848-33761870 CTTGTCTTCCACAGCCACACCGG + Exonic
1174224980 20:48990753-48990775 TTAGTATTCAACAGACATAGTGG + Intronic
1176602131 21:8803261-8803283 CCAGGTTTCCACAGCCTGAGTGG - Intergenic
1176625856 21:9091466-9091488 CCAGGTTTCCACAGCCTGAGTGG + Intergenic
1179957235 21:44748530-44748552 CTCGTTTTCCAAAGACACAGAGG - Intergenic
1180344414 22:11694812-11694834 CCAGGTTTCCACAGCCTGAGTGG - Intergenic
1183388134 22:37526735-37526757 TTGGGTTTCCACAGCCACAGAGG - Intergenic
951862368 3:27267303-27267325 ATAGTTTGCCTCAGCCCTAGAGG + Intronic
952458955 3:33504233-33504255 CTAATAATCCACTGCCATAGAGG + Intronic
952855224 3:37764684-37764706 GTAGCTTTCCACAGCCAGAGGGG - Intronic
955095983 3:55798664-55798686 CAAGTTTTCCACAGCAACAGTGG + Intronic
956682584 3:71795132-71795154 CTAGTTTTTCCCAACCATACTGG + Intergenic
957346359 3:78966202-78966224 CAATTTTTCCACAGACAGAGAGG - Intronic
957389315 3:79542107-79542129 ATATTTTTTCACAGCCATTGGGG + Intronic
960537585 3:118830398-118830420 CAGTTTTTCCACAGCCATGGGGG - Intergenic
961542083 3:127606885-127606907 CTGGTCTTCCACAGCCTGAGAGG - Intronic
963314119 3:143740830-143740852 GTAGTTTTCCACAGAGATACAGG + Intronic
973365453 4:49205068-49205090 CCAGGTTTCCACAGCCTGAGTGG - Intergenic
973395140 4:49587386-49587408 CCAGGTTTCCACAGCCTGAGTGG + Intergenic
973695559 4:53487070-53487092 GCAGTTTTCATCAGCCATAGTGG - Intronic
975198880 4:71561395-71561417 CTAATTGTACACAGCCATAGTGG + Intronic
981088231 4:140705640-140705662 CTAGTATTCTACATCAATAGAGG - Intronic
983950497 4:173634205-173634227 CTAGTGTTCCACACCAACAGAGG - Intergenic
990042719 5:51392183-51392205 CATGTTTTCCACATCCAGAGAGG + Intronic
990303976 5:54477036-54477058 CTATTTCTCCACATCCAAAGAGG - Intergenic
993411029 5:87573315-87573337 ATTGTTTTCCACGGCCATAATGG + Intergenic
993605797 5:89989461-89989483 CTAGTTTTTCACAGGCCAAGAGG - Intergenic
993893207 5:93500195-93500217 CTAGGCTTTCACAGCTATAGAGG + Intergenic
993923024 5:93830758-93830780 ACAGTTTTCCACAGACAGAGTGG + Intronic
995881032 5:116845042-116845064 CAAGTTTTCCACAGACAGAGGGG + Intergenic
1005734681 6:28734402-28734424 CTGGTTTCCTACAGCCAAAGAGG - Intergenic
1008911879 6:56742986-56743008 CTAAAATTCCACAGCCAAAGTGG + Intronic
1011167478 6:84465209-84465231 CCACATTTCCACAGTCATAGTGG - Intergenic
1011639223 6:89403519-89403541 ATAGTATTCCACAGACATAAAGG - Intronic
1011900517 6:92289277-92289299 CCAGATTTCCATAGACATAGTGG + Intergenic
1013618652 6:111868220-111868242 CTAGTTTTGCAGAGCTATAAAGG - Intronic
1014397426 6:120943032-120943054 TTACTTTTCCACAGCCATTGGGG + Intergenic
1017088834 6:150740326-150740348 CTCTTTTTCCTTAGCCATAGTGG + Intronic
1018017244 6:159723676-159723698 CTAGTTTGCCACAAACAGAGGGG - Intronic
1020446283 7:8272093-8272115 CCTGTTTTCAACAGCCAAAGGGG - Intergenic
1020560450 7:9724910-9724932 TTAGTTTTCCACATCCATTTTGG - Intergenic
1023606225 7:41933606-41933628 CTATCTTTCCACAGCTCTAGGGG - Intergenic
1023851064 7:44150796-44150818 CTTCTTTTCCACAGCATTAGAGG + Intronic
1025802180 7:64796729-64796751 TTCGTTTTCCACAGCCAAAATGG - Intronic
1030435750 7:109517775-109517797 CTATTTTTCCACAGACACTGGGG + Intergenic
1031042997 7:116858214-116858236 ACACTTTTCCACAGCCATAAAGG + Intronic
1035596584 8:862924-862946 GTACTTTTCCACTGCCACAGAGG + Intergenic
1036081067 8:5556048-5556070 CTACTATTCCACAGCCAGAGTGG + Intergenic
1038827208 8:31016924-31016946 CTAGTTTCTCAGAGGCATAGTGG + Intronic
1040745332 8:50635229-50635251 TTAGTTTTACAGATCCATAGAGG - Intronic
1046202727 8:110948619-110948641 CTAATTTTGCAATGCCATAGAGG - Intergenic
1047310049 8:123684372-123684394 CTAGCTCTCCAGAGCCACAGAGG + Intronic
1048761205 8:137797461-137797483 CTTGGTCTCCACAGCCCTAGGGG + Intergenic
1051208883 9:14720356-14720378 CTACTTTTTCACAGCCTTCGTGG + Exonic
1051815908 9:21105322-21105344 CTGGTTTTCCACATATATAGTGG - Intergenic
1203749029 Un_GL000218v1:61887-61909 CCAGGTTTCCACAGCCTGAGTGG + Intergenic
1188347326 X:29083009-29083031 CTATTTTTCCACAGCTATCAAGG - Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1199561450 X:149167953-149167975 CTTGTTCTCAAGAGCCATAGTGG - Intergenic