ID: 1065509830

View in Genome Browser
Species Human (GRCh38)
Location 10:26467223-26467245
Sequence CTTTGAGAATAGAAGTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065509828_1065509830 -4 Left 1065509828 10:26467204-26467226 CCTTCTAATGCATTTTTAACTTT 0: 1
1: 0
2: 15
3: 102
4: 844
Right 1065509830 10:26467223-26467245 CTTTGAGAATAGAAGTATGAGGG No data
1065509824_1065509830 9 Left 1065509824 10:26467191-26467213 CCACCGTGCCCAGCCTTCTAATG 0: 1
1: 10
2: 72
3: 743
4: 4368
Right 1065509830 10:26467223-26467245 CTTTGAGAATAGAAGTATGAGGG No data
1065509827_1065509830 0 Left 1065509827 10:26467200-26467222 CCAGCCTTCTAATGCATTTTTAA 0: 1
1: 3
2: 8
3: 76
4: 784
Right 1065509830 10:26467223-26467245 CTTTGAGAATAGAAGTATGAGGG No data
1065509826_1065509830 1 Left 1065509826 10:26467199-26467221 CCCAGCCTTCTAATGCATTTTTA No data
Right 1065509830 10:26467223-26467245 CTTTGAGAATAGAAGTATGAGGG No data
1065509825_1065509830 6 Left 1065509825 10:26467194-26467216 CCGTGCCCAGCCTTCTAATGCAT 0: 1
1: 1
2: 10
3: 88
4: 808
Right 1065509830 10:26467223-26467245 CTTTGAGAATAGAAGTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065509830 Original CRISPR CTTTGAGAATAGAAGTATGA GGG Intronic
No off target data available for this crispr