ID: 1065512033

View in Genome Browser
Species Human (GRCh38)
Location 10:26488917-26488939
Sequence GTGTACATACACATGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065512033_1065512040 26 Left 1065512033 10:26488917-26488939 CCTTGTCCCATGTGTATGTACAC 0: 1
1: 0
2: 1
3: 17
4: 134
Right 1065512040 10:26488966-26488988 TAAGAAATGTGCTAGTTCAATGG No data
1065512033_1065512037 -10 Left 1065512033 10:26488917-26488939 CCTTGTCCCATGTGTATGTACAC 0: 1
1: 0
2: 1
3: 17
4: 134
Right 1065512037 10:26488930-26488952 GTATGTACACCTGATTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065512033 Original CRISPR GTGTACATACACATGGGACA AGG (reversed) Intronic
900584675 1:3427033-3427055 GTGCACATACACATGCGTGACGG + Intronic
901582207 1:10253813-10253835 CTGTACATAATCATGTGACAAGG - Intronic
904922107 1:34015896-34015918 GGGTGCATGCACCTGGGACATGG + Intronic
905119036 1:35667606-35667628 CGGTGCATACACATGGGGCAGGG - Intergenic
905890253 1:41514432-41514454 GTGTACACACACATCTGCCACGG + Intronic
907791358 1:57667973-57667995 GTGTAGGTATACATGTGACATGG - Intronic
909816196 1:79997165-79997187 GTGTACATATACATAGTAAATGG - Intergenic
909881921 1:80890655-80890677 GTGGACATTCACATGAGAAAAGG + Intergenic
916213602 1:162377693-162377715 ATACACATACACATGGGGCAGGG - Intronic
1063429993 10:5979851-5979873 ATGGACATACACATGGAAAAGGG - Intergenic
1065512033 10:26488917-26488939 GTGTACATACACATGGGACAAGG - Intronic
1065996925 10:31068094-31068116 ATGTAGATATACATGGGCCATGG - Intergenic
1067182374 10:43998264-43998286 TTGTACAAAAACATGGAACAGGG + Intergenic
1067231388 10:44413358-44413380 GTAGATATAGACATGGGACAGGG - Intergenic
1073253192 10:102134145-102134167 GTCAACATACACCTGGGACAAGG + Intronic
1078754906 11:14199983-14200005 GTGTAAAAACGCATGGGGCATGG - Intronic
1079471999 11:20787181-20787203 GACTACACACACATGGAACAGGG - Intronic
1082812128 11:57484725-57484747 GTGTGCACACTCATGGCACATGG + Exonic
1082920753 11:58490802-58490824 CTGTAATTACACATGGGGCAGGG + Intergenic
1091782736 12:3224261-3224283 GTGCACTTACAGATGGGACCGGG + Intronic
1093807736 12:23455353-23455375 GTGTAGAAGAACATGGGACAGGG - Intergenic
1100019476 12:90051770-90051792 GTGTAGATATCTATGGGACATGG - Intergenic
1101679407 12:106950431-106950453 GGGTACATACACTTGGGAAATGG - Intergenic
1106065062 13:26339314-26339336 CTGTACATTCACATGGGAGGGGG - Intronic
1107290203 13:38843272-38843294 GTGAACTTAAACATGGTACAAGG + Intronic
1109872178 13:68346345-68346367 ATGTAGATAGACATGGAACAGGG + Intergenic
1110580362 13:77115435-77115457 GTGTGCACACACATAAGACAAGG + Intronic
1111674761 13:91373468-91373490 GTGTGAGTACACCTGGGACAGGG + Intergenic
1113605157 13:111599809-111599831 CTGTACATCCATAAGGGACATGG + Intronic
1113723105 13:112575824-112575846 GTCAACACACACATGGGCCAAGG + Intronic
1115327556 14:32158645-32158667 GTTTCAATACATATGGGACATGG + Exonic
1115758140 14:36549955-36549977 GTGGACACCCACATGGGAGAGGG + Intergenic
1118470946 14:66074893-66074915 GTATACTTCCAAATGGGACAAGG - Intergenic
1119027265 14:71164070-71164092 GTGTAAATACCCGTGGGCCATGG - Intergenic
1128241998 15:66107584-66107606 CTCTTCACACACATGGGACATGG + Intronic
1133991075 16:10708046-10708068 GTGTACATTCACCTGCGATAGGG - Intergenic
1137013785 16:35352296-35352318 GTGTACATACACAATGGAATAGG + Intergenic
1137812605 16:51367202-51367224 GTGTATATACACATATAACAAGG + Intergenic
1139339741 16:66260388-66260410 GTGTAAATATGCATGGGAAAGGG - Intergenic
1140268408 16:73440797-73440819 GTGTTTATACACATGGGAGCTGG - Intergenic
1140809494 16:78563801-78563823 ATGTACATATGCAGGGGACAGGG - Intronic
1143047461 17:4093664-4093686 GTGTGCATACACATCAGCCAGGG - Intronic
1145908900 17:28531503-28531525 GTGGACAAACACATCAGACAGGG + Intronic
1153523087 18:5969949-5969971 GTGTACATACACATCCCAGATGG - Intronic
1156481846 18:37441307-37441329 GTGTACACACACGGGGGAGATGG + Intronic
1158534889 18:58299038-58299060 GTTTACATACACATGCGATAAGG + Intronic
1159331400 18:66998626-66998648 GAGTACATACACATGAAACAAGG + Intergenic
1159778822 18:72637522-72637544 CTGTTCATTCACATGTGACATGG - Intronic
1166491630 19:43265779-43265801 GTGGACAAGAACATGGGACAGGG - Intronic
1166592396 19:44011466-44011488 TTGTACATATATATGGGATATGG + Exonic
925162605 2:1696013-1696035 GTGTTCAGACACAGGGCACAGGG - Intronic
925904263 2:8529868-8529890 GTGTATACACGCATGGGGCAGGG - Intergenic
928986241 2:37185167-37185189 ATGTACAGACACATGAGAAATGG + Intronic
931967719 2:67551854-67551876 GTGTACAAAGAAATGGCACATGG + Intergenic
934895781 2:98118329-98118351 GTTGACAGACACATGGGACAGGG + Intronic
937698804 2:124839945-124839967 GTGAACAAATACATGTGACAAGG + Intronic
937711506 2:124985115-124985137 ATGTACATAATCATGGGACATGG + Intergenic
938243339 2:129759435-129759457 GTGTGCACACCCATGGGACATGG - Intergenic
939180197 2:138795020-138795042 GTGTACATACCCCTGGGAAGCGG - Intergenic
941217349 2:162729076-162729098 ATGTACATATATATGGGCCAAGG - Intronic
941750086 2:169126260-169126282 CTGTACATAGAAATGGGAAAAGG - Intergenic
942807600 2:179951290-179951312 GTGTACATACACAACAGAGAAGG - Intronic
946155422 2:217803780-217803802 GTCTACAAACACATGGGACAAGG + Exonic
947326340 2:228982343-228982365 AGGTACGTACACATGTGACATGG - Intronic
1170013786 20:11757603-11757625 CTCCACATCCACATGGGACAAGG - Intergenic
1172890247 20:38259240-38259262 GTGTACACACACATGGCTCTTGG - Intronic
1173032979 20:39379335-39379357 GTGTATTTGCACATGGCACATGG - Intergenic
1174183089 20:48687169-48687191 GGGGACCTACACATGGGAGATGG - Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176346914 21:5756916-5756938 GTGTACATACACACGGGGCCAGG + Intergenic
1176353728 21:5877500-5877522 GTGTACATACACACGGGGCCAGG + Intergenic
1176497913 21:7567539-7567561 GTGTACATACACACGGGGCCAGG - Intergenic
1176541235 21:8154986-8155008 GTGTACATACACACGGGGCCAGG + Intergenic
1176560186 21:8338031-8338053 GTGTACATACACACGGGGCCAGG + Intergenic
1180247025 21:46555097-46555119 GTGGGTTTACACATGGGACAGGG - Intronic
1182095889 22:27625453-27625475 GTGTGCCTATACATGTGACATGG - Intergenic
1182198756 22:28547241-28547263 GCACACATACACATGGAACATGG + Intronic
1182858126 22:33535819-33535841 GTGAAAATACAGATGGGACGGGG - Intronic
1183139744 22:35925643-35925665 CTGTATTTAAACATGGGACATGG + Intronic
1183585799 22:38752329-38752351 GTGCTCATACACATGGAGCAAGG + Intronic
1184178502 22:42803644-42803666 GTGGTCACACCCATGGGACAGGG - Intronic
1203246177 22_KI270733v1_random:71405-71427 GTGTACATACACACGGGGCCAGG + Intergenic
949577720 3:5355001-5355023 GTGTCCATAATCCTGGGACAGGG + Intergenic
950458743 3:13108461-13108483 GTGGAGATACAAATGGGACGTGG - Intergenic
952536081 3:34310406-34310428 GTGTACAGACACATGGAGCCAGG - Intergenic
956807095 3:72826230-72826252 GTGCACAGACATATGAGACAAGG + Intronic
957429586 3:80084885-80084907 GTGGACACAAACATGGGGCAGGG - Intergenic
958456653 3:94340304-94340326 GAGTACATGGACATTGGACATGG + Intergenic
962164058 3:133030595-133030617 TTCTACATCCTCATGGGACAGGG - Intergenic
963388856 3:144632136-144632158 GTGTGTATTCACATGGTACAAGG + Intergenic
965351786 3:167621334-167621356 GATTACATGCACATTGGACATGG - Intronic
966113004 3:176426226-176426248 GTGTAGATGCACATAAGACAAGG - Intergenic
967341828 3:188406935-188406957 GTATACATACACATGAGAGCTGG - Intronic
967483423 3:190001757-190001779 ATATACATACACATGTCACAAGG + Intronic
969025790 4:4171359-4171381 GTGTACATCCCCATGTGAGATGG + Intergenic
969420248 4:7090245-7090267 GTGTACAGGATCATGGGACATGG - Intergenic
970555295 4:17225635-17225657 CTGTACATACACCTAGGAAAGGG - Intergenic
971725003 4:30300228-30300250 GTGCAGACACCCATGGGACATGG - Intergenic
972318079 4:37946435-37946457 GTGTACATATTTATGGGAGACGG - Intronic
974636986 4:64577954-64577976 GAGGACATACAAATGGGAGAGGG + Intergenic
975019164 4:69466236-69466258 ATGTACAAAACCATGGGACACGG + Intergenic
975134348 4:70859996-70860018 ATGCACATACACATAGGATATGG + Intergenic
976588050 4:86820657-86820679 ATGTTCAGGCACATGGGACATGG - Intergenic
978870997 4:113577827-113577849 ATGTCCAAACACATGGAACATGG - Intronic
978988006 4:115039652-115039674 GTATAGAGAGACATGGGACATGG - Intronic
979378282 4:119975902-119975924 GTATATGTAGACATGGGACAGGG - Intergenic
980590676 4:134883983-134884005 TTTTCCATACACATGAGACATGG - Intergenic
980963839 4:139501806-139501828 GTGTCCATCCACATGTGGCAGGG + Intronic
984160106 4:176241973-176241995 CTGCACATACACCTGGGACGCGG + Intronic
986440620 5:7778359-7778381 TTCTAGAGACACATGGGACATGG + Intronic
990742835 5:58929850-58929872 GTATACATCCACATGGGAATTGG - Intergenic
993902303 5:93592982-93593004 GTGAACAAACACATGGGAGGGGG - Intronic
994373742 5:98995074-98995096 ATGTACATAGACATATGACAGGG - Intergenic
1001937525 5:175715826-175715848 GTGTCCATACACACTGGACGAGG - Intergenic
1002580064 5:180203160-180203182 GTGTTCATACATTTGGGACTGGG + Intronic
1003354028 6:5348425-5348447 GTGTATATACATTTGGGAAATGG - Intronic
1007465411 6:42048279-42048301 GTGTACATACAGAGGGCTCAGGG + Intronic
1007931944 6:45699622-45699644 GTGAACATCTACATGGGAAATGG + Intergenic
1009830598 6:68927150-68927172 ATGTATGTACACATGGTACATGG - Intronic
1018640586 6:165900588-165900610 GTGTATATACACATGGGGGTTGG - Intronic
1019832663 7:3348660-3348682 GGGTACATACACAGGTTACATGG - Intronic
1022849109 7:34241695-34241717 GAATACATCCACATGGGAAATGG + Intergenic
1024474420 7:49795179-49795201 GATTACATACACATGGGACCAGG - Intronic
1025225803 7:57161662-57161684 GTCTACATACATCTGAGACAAGG + Intergenic
1027008605 7:74721499-74721521 GTGTATATGCACATATGACATGG - Intronic
1027750075 7:82132386-82132408 GGGTATGTACACATGGGTCAAGG + Intronic
1032831433 7:135631063-135631085 GTGTACGTACATATGAGAAAGGG + Intronic
1033211538 7:139463624-139463646 GGTCCCATACACATGGGACACGG - Intronic
1034741342 7:153476362-153476384 GTGCACATCCACATGAGCCATGG + Intergenic
1034743762 7:153503683-153503705 GGATACAGACACAAGGGACAGGG - Intergenic
1035654877 8:1298036-1298058 GTGAACAGACACGTGAGACAGGG + Intergenic
1035684398 8:1512902-1512924 GTGCACACACAGATGGCACAGGG - Intronic
1036836209 8:12070672-12070694 ATGGACATAAAGATGGGACATGG + Intronic
1036858051 8:12317241-12317263 ATGGACATAAAGATGGGACATGG + Intergenic
1042667715 8:71224591-71224613 GTTTATTTATACATGGGACATGG + Intronic
1047632455 8:126723064-126723086 ATGTTCATACACATGGGTCATGG - Intergenic
1049160139 8:141092139-141092161 GTGTAGATACAGATGGGATAAGG + Intergenic
1051452888 9:17216779-17216801 GGCTTAATACACATGGGACAGGG - Intronic
1053244414 9:36522877-36522899 GTGTATACACACATGGAAAATGG + Intergenic
1055164631 9:73176241-73176263 GTGTACAGGATCATGGGACATGG + Intergenic
1055605582 9:77967197-77967219 GTATACATGTACCTGGGACAGGG - Intronic
1056045895 9:82715476-82715498 ATGTACATAAACATGTGCCATGG + Intergenic
1056404465 9:86260601-86260623 GTGTCCATTGACAGGGGACAGGG - Intergenic
1056939377 9:90941917-90941939 GTGTACTCACACAGGGGAAAGGG + Intergenic
1059827358 9:118045875-118045897 GTATAAATACACATGCCACAAGG - Intergenic
1062106466 9:134757699-134757721 GTGTGCACACCCATGAGACAGGG + Intronic
1203462511 Un_GL000220v1:54477-54499 GTGTACATACACACGGGGCCAGG + Intergenic
1186352320 X:8752414-8752436 GTGTGCATAAACGAGGGACATGG + Intergenic
1188829577 X:34880155-34880177 GTCTTCATACAAATGGGTCATGG + Intergenic
1193527194 X:82606938-82606960 GTTTAGAAACACATGGCACATGG + Intergenic
1197969823 X:132102843-132102865 ATATACAAACACATGGAACATGG - Intronic
1199516229 X:148678781-148678803 ATGTACATATTTATGGGACAGGG - Intronic
1199573771 X:149293050-149293072 GAGTACATGCACATGGAAGATGG - Intergenic