ID: 1065512759

View in Genome Browser
Species Human (GRCh38)
Location 10:26495383-26495405
Sequence CTCATTCCTGCAGCCAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065512752_1065512759 27 Left 1065512752 10:26495333-26495355 CCTCCTATGGTGGAGGAGAGTTT 0: 1
1: 0
2: 1
3: 11
4: 109
Right 1065512759 10:26495383-26495405 CTCATTCCTGCAGCCAGTGGGGG No data
1065512753_1065512759 24 Left 1065512753 10:26495336-26495358 CCTATGGTGGAGGAGAGTTTAAG 0: 1
1: 0
2: 2
3: 12
4: 176
Right 1065512759 10:26495383-26495405 CTCATTCCTGCAGCCAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065512759 Original CRISPR CTCATTCCTGCAGCCAGTGG GGG Intronic
No off target data available for this crispr