ID: 1065514803

View in Genome Browser
Species Human (GRCh38)
Location 10:26514651-26514673
Sequence CTGTAAAAGGGAAAGGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065514803_1065514808 10 Left 1065514803 10:26514651-26514673 CCAGACACCTTTCCCTTTTACAG 0: 1
1: 0
2: 0
3: 19
4: 236
Right 1065514808 10:26514684-26514706 AAAAAGTGTCATATCACTAGAGG No data
1065514803_1065514811 21 Left 1065514803 10:26514651-26514673 CCAGACACCTTTCCCTTTTACAG 0: 1
1: 0
2: 0
3: 19
4: 236
Right 1065514811 10:26514695-26514717 TATCACTAGAGGGAGAATTAGGG No data
1065514803_1065514809 11 Left 1065514803 10:26514651-26514673 CCAGACACCTTTCCCTTTTACAG 0: 1
1: 0
2: 0
3: 19
4: 236
Right 1065514809 10:26514685-26514707 AAAAGTGTCATATCACTAGAGGG No data
1065514803_1065514810 20 Left 1065514803 10:26514651-26514673 CCAGACACCTTTCCCTTTTACAG 0: 1
1: 0
2: 0
3: 19
4: 236
Right 1065514810 10:26514694-26514716 ATATCACTAGAGGGAGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065514803 Original CRISPR CTGTAAAAGGGAAAGGTGTC TGG (reversed) Intronic
900811379 1:4803872-4803894 CTGGAAGAAGGAAAAGTGTCAGG - Intergenic
901315236 1:8302719-8302741 CTGTAGAAATGAAAGATGTCTGG - Intergenic
904008865 1:27378711-27378733 CTGTAAAGGGGCAAGGGGTGGGG + Intergenic
904894053 1:33800806-33800828 CTGTAAAAGGGAAAGGAATGAGG + Intronic
905368918 1:37472379-37472401 CTGTAAAAGGGACTGTTGTGAGG + Intergenic
905942436 1:41874837-41874859 CTGGAGAAGGGAAAGGTAGCTGG - Intronic
906546367 1:46622018-46622040 TTGTAAAAGGGAAAGGTTCTTGG + Intergenic
908757853 1:67485479-67485501 CCTTCAAAGGGAAAGGTGTAGGG + Intergenic
910689404 1:89950394-89950416 CACAAAAAGGCAAAGGTGTCAGG + Intergenic
913551646 1:119922600-119922622 GTGTAAAGGGGAAAGGTGGCGGG - Intronic
914222100 1:145690307-145690329 CTATGAAATGGAAAGGTGTAGGG - Intronic
914754045 1:150553141-150553163 CTGTACAAGGGGAGGGTTTCTGG - Exonic
916571368 1:166030758-166030780 CAGTAAAAGGAAAGGGTGTGAGG - Intergenic
916600717 1:166290719-166290741 ATGTGAAAGGGGAAGGGGTCTGG + Intergenic
917076183 1:171207467-171207489 CTGGAAAAGGGAAGTGTGTCTGG - Intronic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920430764 1:205917421-205917443 CAGGAAAAGGGACAGGTGGCCGG + Intronic
920789810 1:209079155-209079177 CTGTAAAATGGAGATGTGTTTGG + Intergenic
921127802 1:212193451-212193473 CTGGAAAAGGAAAATGTGTGTGG - Intergenic
921472553 1:215567140-215567162 ATGTAAAAGGGAAAGGGGCTGGG + Intergenic
921593842 1:217033610-217033632 CTTTAAAAGGGAGAGATGTATGG + Intronic
921848603 1:219909913-219909935 GTGTAGAAGGGAAAGCTGTTTGG - Intronic
922072148 1:222205013-222205035 CTGTAGTAGGGAAAGGAGGCTGG - Intergenic
924565887 1:245198070-245198092 CTGCAAAAGGGAAGGATGTGTGG - Intronic
1063949400 10:11208173-11208195 CTGTAAAATGGGAGGGTGTGGGG + Intronic
1065514803 10:26514651-26514673 CTGTAAAAGGGAAAGGTGTCTGG - Intronic
1067695948 10:48535873-48535895 CTGAGAAAGGGAAGGGTGTCGGG - Intronic
1067798104 10:49335362-49335384 CTGGAAAAGGGTGAGGTTTCAGG - Intergenic
1068472182 10:57479498-57479520 TTGAGAAAGGTAAAGGTGTCAGG - Intergenic
1074642465 10:115402775-115402797 CAGTAAATGGGAAAGGTATAAGG - Intronic
1075147918 10:119898611-119898633 TTGTAAAAGGGAGAGCAGTCAGG - Exonic
1078746036 11:14115072-14115094 CTGTAAGAGGCAAAGGTGGGAGG - Intronic
1078950735 11:16130912-16130934 CTGTAAAGGAAAAAGATGTCTGG + Intronic
1079012498 11:16840952-16840974 CTGTCAAAGAGCAAAGTGTCAGG + Intronic
1080319992 11:30997123-30997145 ATGTAAAAGGAAAAGCTGTAGGG + Intronic
1080784103 11:35459336-35459358 CTGTCAAATGGGAATGTGTCAGG - Intronic
1080884320 11:36352510-36352532 CTGTAAAGGGGAAAGGGGGAAGG - Intronic
1081779281 11:45698909-45698931 CTGCAAAAGGGAAGGATGCCTGG + Intergenic
1081912051 11:46705859-46705881 CAGCAAAAGGCAAAGCTGTCAGG - Exonic
1085345534 11:75766009-75766031 GGGGAAAGGGGAAAGGTGTCAGG - Intronic
1086737645 11:90326847-90326869 CTGTAAAATGGCAATCTGTCTGG + Intergenic
1086824154 11:91475164-91475186 GTGAAAGAGTGAAAGGTGTCAGG + Intergenic
1089572483 11:119419672-119419694 CTGCAAATGGGAAAGATGGCTGG - Intronic
1092205234 12:6610787-6610809 CAGGAAAAGGGAAAAGTGACAGG - Intergenic
1092652802 12:10652980-10653002 CTGAAATAGGGAAAGGAGTCAGG + Intronic
1092814833 12:12303861-12303883 CTGTTAAAGGGACAGAAGTCTGG + Intergenic
1093089104 12:14901788-14901810 CTGTAGATGGGAAATGTGGCAGG + Intronic
1094572705 12:31655307-31655329 CTACAAAAGGAAAAGGTCTCAGG + Intronic
1095987514 12:48009321-48009343 CGGGAAAAGATAAAGGTGTCTGG + Intergenic
1096267442 12:50135072-50135094 ATGTAAAAGTGAAAGGAGACAGG + Intronic
1096394166 12:51253005-51253027 CTGAGAAAGAGAAAGGGGTCGGG + Intronic
1096540872 12:52306288-52306310 CTGGGAAAGGGAAAGGTCTATGG - Intronic
1097704082 12:62849586-62849608 TTTTAAGAGGGAAAGGTGCCAGG + Intronic
1098546951 12:71721960-71721982 CTGCAAAAGGGAGGGGAGTCTGG - Intergenic
1099335567 12:81352339-81352361 CAGGAAAAGGGAAAGGTGGGTGG + Intronic
1100282415 12:93130542-93130564 CAGGAAGAGGGAAAGGGGTCAGG - Intergenic
1100666875 12:96764325-96764347 CTGTAAAAGAGAAAGGAGTTGGG + Intronic
1101083141 12:101209309-101209331 CAGTAGAAGGGAAAGATGCCAGG + Intronic
1102999433 12:117374193-117374215 ATGTAAAAGGGAAAAGGGGCTGG + Intronic
1107317699 13:39151262-39151284 ATGTAAAAGGGAAAGGTGGGGGG + Intergenic
1109502529 13:63256017-63256039 CTGTAATAGGGGGAGGTGTGAGG + Intergenic
1110515795 13:76411308-76411330 ATGGAAAAGGGAAAGGAGTAGGG + Intergenic
1110884329 13:80614206-80614228 CTCAAAAAGGGAAGGGTGGCGGG - Intergenic
1112334772 13:98505149-98505171 CTTTCAAAAGGAAAAGTGTCCGG + Intronic
1112337525 13:98527422-98527444 CTGCAAAGGGGCAAGGTGCCGGG + Intronic
1112733479 13:102393604-102393626 CTGTCTAAGGAAAAGGTATCTGG + Intronic
1113075908 13:106467962-106467984 CTGTAAAAGGGAAAGGTTGAAGG - Intergenic
1113105485 13:106767809-106767831 ATGTGACAGGGAAATGTGTCAGG - Intergenic
1114723843 14:24912394-24912416 TTGTGACAGGGAAAGGTGGCTGG + Intronic
1114816485 14:25964918-25964940 CTGTGAAAGGGAAAGTTGAAGGG - Intergenic
1116256927 14:42569096-42569118 CTGTAAAATGGGAAGGTCTATGG - Intergenic
1119358914 14:74031406-74031428 CTATAAAAGGGAATGATGCCAGG - Intronic
1120456206 14:84733514-84733536 CAGTAAGTGGGAAAAGTGTCTGG - Intergenic
1121835812 14:97091184-97091206 CAGGAAAGGGGAAAAGTGTCTGG + Intergenic
1124033441 15:26031905-26031927 CTGTAAGTGAGAAAGATGTCTGG + Intergenic
1125691354 15:41598694-41598716 CTGTAAAAGGTAACAGTGTGTGG - Intergenic
1127554671 15:60076087-60076109 TTATAAAAGGGAGAGGTGTGAGG + Intergenic
1128923473 15:71633007-71633029 CTGAAAAAAGGCAAGCTGTCGGG - Intronic
1130907130 15:88248621-88248643 CAGTAAATGGGAAAGCAGTCTGG - Intronic
1131621125 15:94069274-94069296 CTCTCAAAGGGAAAACTGTCCGG - Intergenic
1132563713 16:610824-610846 CTCTCAGAGGGACAGGTGTCAGG - Intronic
1133157167 16:3883255-3883277 CTGTAAAATGGAAACCTGTCAGG - Intergenic
1139347838 16:66315878-66315900 AGGTAAGAGGGAAAGTTGTCTGG + Intergenic
1139372978 16:66479969-66479991 CTCGAAGAGGGAAAGGGGTCAGG + Intronic
1139939780 16:70596881-70596903 CTGTAAAATGGAAATGAGGCTGG - Intronic
1140649269 16:77068918-77068940 CTGTAACAGGGAAAGGCATATGG - Intergenic
1141716252 16:85728749-85728771 CTGTAAAATGGAGTGGTGACTGG - Intronic
1143031500 17:3970461-3970483 CTGTAAAATGGAAAGAGGACTGG - Intergenic
1143990301 17:10953623-10953645 CTAAAAAAAGGAAAGGTGTGTGG - Intergenic
1144014128 17:11177704-11177726 GTGATAAAGGGAAAGGTGTAGGG + Intergenic
1145768842 17:27478244-27478266 GTATAAAAGGGGATGGTGTCAGG + Intronic
1145770596 17:27490042-27490064 CTGGAAGATGGTAAGGTGTCGGG + Intronic
1146157239 17:30534930-30534952 CTATAAAAGGGATAGGGCTCAGG - Intergenic
1146374333 17:32284258-32284280 CTGGCAAAGGGAAAGGGGACTGG - Intronic
1146722381 17:35132452-35132474 GTGGAGAAGGGAAGGGTGTCAGG + Intronic
1148150609 17:45394728-45394750 CTGTAAAATGGGATGGTGTGTGG + Exonic
1149184957 17:53986513-53986535 TTGTAAAAGGGAAAGGAGGGAGG - Intergenic
1149353493 17:55815675-55815697 ATTTAAAGGGGAAAGGAGTCAGG - Intronic
1150282965 17:63940188-63940210 CTGGAAAAGGGAAATGTGACTGG - Exonic
1150412524 17:64957926-64957948 CTGTAAAGAGGACAAGTGTCAGG + Intergenic
1152177455 17:78797331-78797353 CCATAAAAGGGAGAGGTGGCTGG + Exonic
1155840110 18:30632966-30632988 CTGAAAAAGAGAGAGGTGGCAGG + Intergenic
1156824036 18:41408162-41408184 CTTTAAAAGGGAAGGGGGTAAGG + Intergenic
1159378734 18:67628932-67628954 CTTGAAAAGGGCAAAGTGTCTGG + Intergenic
1160352995 18:78201076-78201098 CTGTAAACAGGAGAGGGGTCCGG - Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161656334 19:5517799-5517821 CTGTACAAAGGAAAGGTGGCCGG + Intergenic
1163028099 19:14525599-14525621 CTGGAAAAGGCAAAAGTATCAGG + Intronic
1164837230 19:31364475-31364497 CTGGAAAAGGGAAAGCTTTAAGG - Intergenic
1166058805 19:40311600-40311622 CTGTGAAAGCGCAAGGTGTGGGG - Intergenic
1166131855 19:40750434-40750456 CTGGAAAAAGGAAAGGAGTCAGG + Intronic
1166404015 19:42506319-42506341 TTGTAAAAGGAAAAAGTGTGAGG + Intergenic
1166439074 19:42794862-42794884 ATGTAAAAGGCAAAGAGGTCAGG - Intronic
1166474075 19:43105636-43105658 ATGTAAAAGGCAAAGAGGTCAGG - Intronic
1166822028 19:45586461-45586483 CTGTAAAATGGGAAGGGGGCTGG - Intronic
1167124001 19:47536875-47536897 CTGTACAAGGGAAAAATGTTCGG + Intronic
1168565532 19:57419175-57419197 CAGTAAAAGGAACAGGTGGCTGG - Intronic
925154944 2:1641634-1641656 TTTTAAGAGGGAAAAGTGTCCGG + Intronic
925852304 2:8094295-8094317 CTGGCAACTGGAAAGGTGTCTGG - Intergenic
925908246 2:8552491-8552513 CAGGAAAAGGGAAACTTGTCGGG - Intergenic
926392849 2:12411813-12411835 CTGCAAGAGGGTCAGGTGTCTGG - Intergenic
927030376 2:19115190-19115212 CTCTAAAAGGCAGAAGTGTCTGG + Intergenic
927546157 2:23955362-23955384 CTGTAGAGGGGACAGGTGCCTGG + Intronic
928219361 2:29390951-29390973 CTGTGAAAGGAAGAGGTTTCAGG + Intronic
928243900 2:29610687-29610709 CTGTGAAAGGAAAAGGTCACTGG + Intronic
931894660 2:66715797-66715819 CTGGACAGGGGAATGGTGTCAGG - Intergenic
932010257 2:67970451-67970473 CTTTTAAAGGGAAAGGAGGCTGG + Intergenic
932163381 2:69483273-69483295 CTGGAAAAGGCAAAGCTGTAGGG - Intronic
936718806 2:115223703-115223725 CTGAAAAATGGAAAGCTGTTGGG + Intronic
937608501 2:123830850-123830872 CTGGAAAACGTAAAAGTGTCTGG - Intergenic
937905723 2:127051906-127051928 CTGTAAAAGGAGGAAGTGTCTGG + Intronic
939481528 2:142753989-142754011 ATGGAGAAGGGAAAGGTGTGAGG + Intergenic
940210687 2:151253718-151253740 CTGGATCATGGAAAGGTGTCTGG - Intronic
946242774 2:218367194-218367216 CTGTAAACGGGACAGGAGCCTGG + Intronic
947388104 2:229612414-229612436 CTGTAAAGGGGGAAGGCATCTGG + Intronic
948342778 2:237268617-237268639 CTGTAAAAGGGAATCATGACTGG + Intergenic
1171308174 20:24123780-24123802 CTGGAAATGGTAAAGGTGGCAGG + Intergenic
1171393397 20:24815721-24815743 CTTAAAACTGGAAAGGTGTCTGG - Intergenic
1171435081 20:25116073-25116095 CAGTAAAAGGCAAAGGCATCTGG - Intergenic
1171568725 20:26223826-26223848 CTTTATAATGGAAAGGTGCCAGG + Intergenic
1172215467 20:33232716-33232738 CTGAACAGGGGAAAGGTCTCAGG - Intergenic
1173745853 20:45436695-45436717 CTGTAAAAGGGAAATGGTACTGG - Intergenic
1174551102 20:51362342-51362364 CTGGCCAAGGGAAAGGTGACAGG + Intergenic
1176205028 20:63883608-63883630 CTGAGAATGGGAAAGGGGTCAGG - Intronic
1177405557 21:20663138-20663160 CTCTCAAAGGGAAAGGGGACTGG - Intergenic
1178062972 21:28872529-28872551 CTATGAAAGAGAAAGGTGACAGG - Exonic
1182157728 22:28091530-28091552 ATGAAAAAGGGAAAGGTAGCAGG + Intronic
1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG + Intronic
1182690752 22:32160104-32160126 CCGTAAAATGGAATGGTTTCTGG - Intergenic
1183550866 22:38483990-38484012 CTGTTTGAGGGAAAGGTCTCTGG - Exonic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
952339889 3:32436697-32436719 CTTCCAAAAGGAAAGGTGTCTGG + Intronic
953373021 3:42406156-42406178 TTGAAAAAGGGAGAGGGGTCAGG + Intronic
954753202 3:52825089-52825111 CTGAAAAAGGGCAAGGTTTTGGG - Intronic
955475140 3:59328784-59328806 TGGAAAAAGGGAAAGGTGGCTGG + Intergenic
955663516 3:61326346-61326368 CTGTGAATGGGAAGGCTGTCTGG - Intergenic
956722630 3:72131822-72131844 CTATAAAATGGGAATGTGTCTGG + Intergenic
957110121 3:75944526-75944548 CTTTATAATGGAAAGGTGCCAGG - Intronic
957255281 3:77827923-77827945 CAGCAAAAGGAAAAGGTGTGTGG + Intergenic
957700526 3:83705067-83705089 CTGTAAAAGTGACAAGTGCCTGG - Intergenic
958678945 3:97300708-97300730 CTATCAAAGGGACAGGGGTCAGG + Intronic
960079820 3:113529593-113529615 TTATAAAAGGGGAAGGTTTCAGG + Intergenic
960807748 3:121600360-121600382 CTGTGAAAGGGAAGGTTGTAGGG - Intronic
961361386 3:126370341-126370363 CTGTAAACAGTAAAGGTCTCTGG - Intergenic
962330892 3:134476855-134476877 CTCTAAACTGGAAAGCTGTCAGG + Intergenic
962655916 3:137543743-137543765 CTGAAGCAGGGCAAGGTGTCGGG + Intergenic
962829227 3:139125201-139125223 ATGTAAAAGGAAAAGGTATGTGG + Intronic
965298792 3:166984146-166984168 CTGTTGAAGTGAAAGTTGTCAGG + Intergenic
966226472 3:177603401-177603423 TTGTAAAAGGGAAAGGGGTGAGG - Intergenic
966862237 3:184236903-184236925 CTGTGAAGGCCAAAGGTGTCAGG + Intronic
967452857 3:189646615-189646637 TCGTGAAAGGGAAAGGTGTATGG - Intronic
968056031 3:195692474-195692496 CTGGAAAAAGGAAAAGTGACTGG + Intergenic
968353971 3:198086914-198086936 CTGCCAAAGATAAAGGTGTCAGG - Intergenic
969381548 4:6802287-6802309 CTGGAAGAGGGCAAGATGTCGGG + Intronic
969523967 4:7694859-7694881 CTGTCCAAGGGAAAGGGGACTGG - Intronic
974873071 4:67667758-67667780 CTTAAAAATGGAAAGATGTCAGG - Intronic
976832887 4:89334892-89334914 CTTTAAAAGTGCCAGGTGTCAGG + Intergenic
977238837 4:94541980-94542002 CTGAAAAAGTGAATGGAGTCGGG + Intronic
979157772 4:117419536-117419558 CTATAAAGGGGAAAGGTATGAGG - Intergenic
980767350 4:137323960-137323982 CTGTAAGAGGGAAAGGATTGGGG + Intergenic
981340908 4:143620264-143620286 GTGGAAAAAGGAAAGGTATCAGG - Intronic
981700456 4:147602207-147602229 CTGTAAGAATGCAAGGTGTCAGG - Intergenic
982835142 4:160113860-160113882 CTGTAAATTGGAAAGATGTGTGG + Intergenic
983573851 4:169238970-169238992 CTGAAAAAGGGCAAGGGGTGGGG - Intronic
985503928 5:267316-267338 CTGGAAAAAGGAAAAGTGACTGG + Intergenic
985812768 5:2102346-2102368 CTGTGAAAGGCCAAGGTGGCTGG - Intergenic
985999897 5:3622166-3622188 TTGTAAAAGGGTAAACTGTCAGG + Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
989093830 5:37762557-37762579 ATGTAAAATGGAAAGGTTTATGG - Intergenic
989477161 5:41887852-41887874 GTGTAAAATGGAAAGGTTCCAGG - Intergenic
992127398 5:73655866-73655888 CTGTAAAAGGGAAGAGTTTGGGG + Intronic
992773536 5:80070401-80070423 CTGTAAAAAGGTAAGGGGTGTGG + Exonic
998589038 5:143457700-143457722 CCTTAAAAAGGAAAGGTGTCTGG + Intergenic
1000970954 5:167714188-167714210 AAGTAAGAGGGAAATGTGTCAGG - Intronic
1001023401 5:168203352-168203374 CTCTAAAGGGGAATTGTGTCAGG + Intronic
1001042301 5:168345395-168345417 CTTTAAAAGGGAAGGATTTCAGG - Intronic
1001871727 5:175161977-175161999 CTGGAAAATGTAAAGGTGTCAGG + Intergenic
1001887574 5:175309284-175309306 CAGTGAAAGGGCAAGGTATCTGG - Intergenic
1002854305 6:1023702-1023724 CTGCAGAAGGAAAAGGAGTCTGG - Intergenic
1006373736 6:33660290-33660312 CTGTTAGAGGGACAGGTGACAGG + Intronic
1007745157 6:44039140-44039162 CTGGAATGGGGAAAGGTGTGCGG + Intergenic
1010142228 6:72624062-72624084 TTGTAAAACGGAAAGTTGGCTGG - Intronic
1012627238 6:101419228-101419250 CTGGAAAGGTGAAAGGTGTGAGG - Intronic
1012991383 6:105929981-105930003 CTGGAAAAGAGAAAGGTGCTTGG - Intergenic
1016336933 6:143016635-143016657 TTGTAGAAGGCAAAGATGTCAGG + Intergenic
1017435197 6:154409097-154409119 GTGAAAAAGGGAAAGATGCCTGG - Intronic
1018897069 6:168027154-168027176 TAGAAAAAGGGAAAGGTGGCCGG + Intronic
1018965069 6:168478707-168478729 CTGTCTCAGGGAAAGGAGTCAGG + Intronic
1019535218 7:1525716-1525738 ATGTAAAAGGGACAGGTGCAAGG - Intergenic
1020508315 7:9020452-9020474 TTGTAAAAGGGAAAGGGGGGAGG + Intergenic
1020963798 7:14840621-14840643 TTGTAAAAGAAAGAGGTGTCAGG - Intronic
1021388557 7:20063563-20063585 CTGGAAAAGGGAGAGGCATCTGG + Intergenic
1023142500 7:37116128-37116150 CTTTGAAGGGGAAAGGTTTCTGG - Intronic
1023862611 7:44225314-44225336 CTGTAGAAGTGGCAGGTGTCGGG + Intronic
1025899674 7:65733619-65733641 CTGGAAGAGGGAGAGGTGTCTGG - Intergenic
1026813063 7:73485263-73485285 CTGTAAAAGGGCATCCTGTCTGG + Intronic
1027917434 7:84343569-84343591 CTCTCTAAGGGAAATGTGTCTGG + Intronic
1028146884 7:87328968-87328990 ATGTAAGAGGGAAAGGAATCAGG + Intergenic
1028530680 7:91835053-91835075 CTGCAATAGGGAAAGCTTTCAGG - Intronic
1029307677 7:99632504-99632526 CTGTAAAAGGTAAGGGCGGCTGG + Intergenic
1029676364 7:102071847-102071869 CTGTAAAATGGAACAGGGTCAGG + Intronic
1030848298 7:114450536-114450558 CTCTAAAAATGACAGGTGTCAGG + Intronic
1031020488 7:116622234-116622256 CTGTATAAGGGAATGGAGTGAGG + Intergenic
1034330757 7:150280216-150280238 CTGTAAAATGGACCGGAGTCTGG - Intronic
1034459580 7:151191135-151191157 CTGTAAAAGGGGGAGGGGTGAGG - Intronic
1034667287 7:152829633-152829655 CTGTAAAATGGACCGGAGTCTGG + Intronic
1035067983 7:156121883-156121905 CTGCAAGAAGGAAAGGTGTGGGG - Intergenic
1035959616 8:4122740-4122762 CTGTGAAAGGGGAAGATTTCTGG + Intronic
1037274119 8:17159159-17159181 CTGTGAAAAGGAAAGGAGTCTGG - Intronic
1039548021 8:38423599-38423621 TTGTAAAAGGGAAAGAAGGCCGG - Intronic
1042424335 8:68629454-68629476 CTGGAAAAGGGAGATGTGGCAGG - Intronic
1045308173 8:100977094-100977116 CTTTAAGAGGGAAAGGTGGGTGG + Intergenic
1045478370 8:102572830-102572852 CTGTTAGAGGGAATGGTGTTGGG + Intergenic
1046555673 8:115769391-115769413 CTGTAAATGCGGAAGGTGTGAGG + Intronic
1048151294 8:131897461-131897483 CTGTTAAAGGGTAAGCTGGCTGG + Intergenic
1053064456 9:35057711-35057733 CTGGAAAAGGGAAAACTGTAGGG + Intronic
1053329821 9:37193953-37193975 CTGTAAGAGGGAAAGGGATGAGG - Intronic
1055076254 9:72218338-72218360 CTTTTAAGGGGAAAGGGGTCTGG - Intronic
1055087600 9:72330026-72330048 TAGTAAAAGGGAAAGGAGTAAGG - Intergenic
1055461285 9:76522905-76522927 CTTTAAAATGGTAATGTGTCCGG + Intergenic
1057761749 9:97880296-97880318 CTATAAAAGGGAAAGCTGTAAGG - Intergenic
1058478603 9:105367654-105367676 CTGCAAAAGCAAAAGGTGCCTGG - Intronic
1058507239 9:105678598-105678620 CTTTAAAAGGGAGAGGGGGCAGG - Intergenic
1058660859 9:107267361-107267383 CTTTAATAGGGAAAAGTGTCAGG - Intergenic
1061834443 9:133319522-133319544 CAGTAAGAGGGAAAGGGGCCTGG + Intergenic
1186270302 X:7879416-7879438 CTGTGAAGGGGACAGATGTCTGG - Intergenic
1186995560 X:15117761-15117783 TTCTAAAAGGCAAAGATGTCTGG - Intergenic
1188676150 X:32942058-32942080 TTGTAAAGGGGAAACGTCTCTGG - Intronic
1188735518 X:33709781-33709803 CTGTAATATCCAAAGGTGTCTGG - Intergenic
1191724542 X:64265731-64265753 CTGTAAAACTAAAAGGTGTTTGG + Intergenic
1193102776 X:77634983-77635005 CTCTAAAAGAGAAACGTGGCCGG + Intronic
1193161554 X:78234127-78234149 TTGTAAAAGTGACAGGTTTCAGG - Intergenic
1194721429 X:97344575-97344597 TTGTAAAAGGGATAGATGGCTGG - Intronic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1198413391 X:136394410-136394432 GTGAAAAAGGGAAAGGTTCCAGG - Intronic
1198924751 X:141776746-141776768 TTTTAAAAGGGATAGATGTCGGG - Intergenic