ID: 1065518922

View in Genome Browser
Species Human (GRCh38)
Location 10:26552891-26552913
Sequence GAGTTAGAGCCCCCAAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065518922_1065518923 -9 Left 1065518922 10:26552891-26552913 CCTTGGTTTGGGGGCTCTAACTC No data
Right 1065518923 10:26552905-26552927 CTCTAACTCACTCCCCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065518922 Original CRISPR GAGTTAGAGCCCCCAAACCA AGG (reversed) Intronic
No off target data available for this crispr