ID: 1065518923

View in Genome Browser
Species Human (GRCh38)
Location 10:26552905-26552927
Sequence CTCTAACTCACTCCCCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065518916_1065518923 12 Left 1065518916 10:26552870-26552892 CCACAGACATTTTCAAATATTCC No data
Right 1065518923 10:26552905-26552927 CTCTAACTCACTCCCCTCAGTGG No data
1065518915_1065518923 19 Left 1065518915 10:26552863-26552885 CCTTGGGCCACAGACATTTTCAA No data
Right 1065518923 10:26552905-26552927 CTCTAACTCACTCCCCTCAGTGG No data
1065518922_1065518923 -9 Left 1065518922 10:26552891-26552913 CCTTGGTTTGGGGGCTCTAACTC No data
Right 1065518923 10:26552905-26552927 CTCTAACTCACTCCCCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065518923 Original CRISPR CTCTAACTCACTCCCCTCAG TGG Intronic