ID: 1065518923 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:26552905-26552927 |
| Sequence | CTCTAACTCACTCCCCTCAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1065518916_1065518923 | 12 | Left | 1065518916 | 10:26552870-26552892 | CCACAGACATTTTCAAATATTCC | No data | ||
| Right | 1065518923 | 10:26552905-26552927 | CTCTAACTCACTCCCCTCAGTGG | No data | ||||
| 1065518915_1065518923 | 19 | Left | 1065518915 | 10:26552863-26552885 | CCTTGGGCCACAGACATTTTCAA | No data | ||
| Right | 1065518923 | 10:26552905-26552927 | CTCTAACTCACTCCCCTCAGTGG | No data | ||||
| 1065518922_1065518923 | -9 | Left | 1065518922 | 10:26552891-26552913 | CCTTGGTTTGGGGGCTCTAACTC | No data | ||
| Right | 1065518923 | 10:26552905-26552927 | CTCTAACTCACTCCCCTCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1065518923 | Original CRISPR | CTCTAACTCACTCCCCTCAG TGG | Intronic | ||