ID: 1065519598

View in Genome Browser
Species Human (GRCh38)
Location 10:26558798-26558820
Sequence CAGAAACAACAGAAGCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065519596_1065519598 6 Left 1065519596 10:26558769-26558791 CCTGTCTTAAAAAATAATAAAAA 0: 2
1: 45
2: 1298
3: 19427
4: 33770
Right 1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG No data
1065519594_1065519598 26 Left 1065519594 10:26558749-26558771 CCTGGGCAACAGAGTGAGACCCT 0: 4184
1: 22237
2: 70009
3: 146932
4: 263757
Right 1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG No data
1065519593_1065519598 30 Left 1065519593 10:26558745-26558767 CCAACCTGGGCAACAGAGTGAGA 0: 903
1: 25452
2: 80970
3: 175858
4: 231449
Right 1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG No data
1065519595_1065519598 7 Left 1065519595 10:26558768-26558790 CCCTGTCTTAAAAAATAATAAAA 0: 4
1: 81
2: 1636
3: 22172
4: 40037
Right 1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065519598 Original CRISPR CAGAAACAACAGAAGCAATG AGG Intronic
No off target data available for this crispr