ID: 1065520143

View in Genome Browser
Species Human (GRCh38)
Location 10:26564432-26564454
Sequence CTCATTATGACTCGTGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065520143 Original CRISPR CTCATTATGACTCGTGTCTC AGG (reversed) Intronic
902260509 1:15221499-15221521 CTCTTTGTGTCTCATGTCTCTGG + Intergenic
904873833 1:33638219-33638241 CTCCATATGCCTAGTGTCTCTGG + Intronic
916187530 1:162147514-162147536 CACATTATGATTCGTGTACCAGG + Intronic
917211228 1:172633892-172633914 CTAATGATGACTGGTGGCTCCGG + Intergenic
922042582 1:221911195-221911217 CTCCTTAGGACCCGTGTCTGTGG - Intergenic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1069930597 10:71878920-71878942 CTCATTATCCCTGCTGTCTCTGG + Intergenic
1091111604 11:132974055-132974077 CGCATAATCACTCATGTCTCTGG + Intronic
1093670058 12:21862891-21862913 CTCTTTCTGACTCGTGTGTTTGG - Intronic
1097831968 12:64234679-64234701 CTCATTACCACTAGTGTCTTTGG + Intergenic
1105439611 13:20404407-20404429 CTCATTGTGACTTGTCTCTGAGG - Intronic
1108539185 13:51421261-51421283 CTCATGATGACTGGTGCCTCAGG - Intronic
1111848866 13:93546822-93546844 GTGATTTTGACTTGTGTCTCTGG + Intronic
1113393365 13:109919301-109919323 CTCTTTTTGACTTGTGTGTCAGG - Intergenic
1115399759 14:32942984-32943006 GTCATTATAACTCCTGGCTCTGG - Intronic
1118582719 14:67319402-67319424 CTCATTTTGATTCATGACTCTGG + Intronic
1124548820 15:30658249-30658271 CTCATTAAGACTAGTGTTTATGG + Intronic
1131755091 15:95550833-95550855 TTCATTATGATCCGTGTCACTGG - Intergenic
1143752488 17:9038685-9038707 CTCATGATCACTGGGGTCTCAGG + Intronic
1144217032 17:13065331-13065353 CTCAAGATGCCTCCTGTCTCAGG - Intergenic
1145985431 17:29042880-29042902 CTCATTATGATCTTTGTCTCAGG - Exonic
1147021947 17:37541791-37541813 CTGATTTTGACTCCCGTCTCAGG + Intronic
1166307286 19:41941848-41941870 CTCATTTTGACTTGAGTCTGAGG - Intergenic
1167599428 19:50445750-50445772 CTCATTATGTCTCCTCCCTCCGG + Intronic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
953934458 3:47028188-47028210 CTCATTTTGTCCCTTGTCTCAGG - Intronic
954864520 3:53717571-53717593 CTCAGTATGACTAGGGTCTCTGG - Intronic
960846374 3:122007765-122007787 CTAATTATGATTCGTGCCTTGGG + Intronic
964553049 3:157906378-157906400 TTCATTTTGACTCTGGTCTCTGG - Intergenic
984043249 4:174763922-174763944 CTCATTATGACTCATATATGAGG + Intronic
1009638221 6:66295121-66295143 CTCTTTCTCACTTGTGTCTCTGG + Intergenic
1010042175 6:71397787-71397809 CTCCTCATGACTTCTGTCTCAGG + Intergenic
1010438043 6:75858865-75858887 CTCATAATGACTCTTGGTTCTGG + Intronic
1011790106 6:90889754-90889776 CTTCTTATCACACGTGTCTCGGG + Intergenic
1013289523 6:108708397-108708419 CTCCTGATGTCTAGTGTCTCAGG - Intergenic
1013508927 6:110827012-110827034 TCCATTATGACTAGTGTCTGTGG - Intronic
1022726198 7:32984081-32984103 CTCATTATGGTTCCTGTCTTTGG + Intronic
1027853137 7:83474246-83474268 CCCATTATTACTCATGTATCAGG - Intronic
1028313443 7:89368761-89368783 CTCATGAGATCTCGTGTCTCAGG + Intergenic
1032437035 7:131909125-131909147 CTGATGATGATTCTTGTCTCAGG + Intergenic
1040580529 8:48695235-48695257 CTCCTTATGACTAGTGTGGCAGG - Intergenic
1041914206 8:63123164-63123186 CTCACTTTGACTCGTATCTCCGG - Intergenic
1048815290 8:138328028-138328050 CTTATTATCATTCTTGTCTCGGG + Intronic
1053279953 9:36813836-36813858 CTAATTTTGACTGGTGTTTCAGG + Intergenic
1057475235 9:95394343-95394365 CTCATTATGTCTTGTCTCTTTGG - Intergenic
1060660343 9:125401791-125401813 ATCATCATGACGCCTGTCTCAGG + Intergenic
1192073020 X:67961229-67961251 CTCATTAGCACTCGTTACTCTGG - Intergenic
1192748881 X:73966938-73966960 CCCAGTAAGACTCCTGTCTCTGG + Intergenic
1198734928 X:139775101-139775123 CTCATTCTGAGTGTTGTCTCGGG + Intronic
1201536905 Y:15059250-15059272 GTCATTGTGACACGTGTCTTTGG + Intergenic