ID: 1065522093

View in Genome Browser
Species Human (GRCh38)
Location 10:26582834-26582856
Sequence CCAGAAGACACCCAAAGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065522085_1065522093 22 Left 1065522085 10:26582789-26582811 CCAATTTGGGAGCCAGCGAGGGA No data
Right 1065522093 10:26582834-26582856 CCAGAAGACACCCAAAGGTAGGG No data
1065522086_1065522093 10 Left 1065522086 10:26582801-26582823 CCAGCGAGGGACCTGACAGCAGC No data
Right 1065522093 10:26582834-26582856 CCAGAAGACACCCAAAGGTAGGG No data
1065522088_1065522093 -1 Left 1065522088 10:26582812-26582834 CCTGACAGCAGCACATTGGCCAC No data
Right 1065522093 10:26582834-26582856 CCAGAAGACACCCAAAGGTAGGG No data
1065522082_1065522093 27 Left 1065522082 10:26582784-26582806 CCAGTCCAATTTGGGAGCCAGCG No data
Right 1065522093 10:26582834-26582856 CCAGAAGACACCCAAAGGTAGGG No data
1065522080_1065522093 29 Left 1065522080 10:26582782-26582804 CCCCAGTCCAATTTGGGAGCCAG No data
Right 1065522093 10:26582834-26582856 CCAGAAGACACCCAAAGGTAGGG No data
1065522081_1065522093 28 Left 1065522081 10:26582783-26582805 CCCAGTCCAATTTGGGAGCCAGC No data
Right 1065522093 10:26582834-26582856 CCAGAAGACACCCAAAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065522093 Original CRISPR CCAGAAGACACCCAAAGGTA GGG Intergenic
No off target data available for this crispr