ID: 1065522867

View in Genome Browser
Species Human (GRCh38)
Location 10:26588994-26589016
Sequence CCAGAAGACACCCAAAGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065522859_1065522867 27 Left 1065522859 10:26588944-26588966 CCAGTCGAATTTGGGAGCCAGTG No data
Right 1065522867 10:26588994-26589016 CCAGAAGACACCCAAAGGTAGGG No data
1065522860_1065522867 10 Left 1065522860 10:26588961-26588983 CCAGTGAGAGTCCTGACAGCAGC No data
Right 1065522867 10:26588994-26589016 CCAGAAGACACCCAAAGGTAGGG No data
1065522858_1065522867 28 Left 1065522858 10:26588943-26588965 CCCAGTCGAATTTGGGAGCCAGT No data
Right 1065522867 10:26588994-26589016 CCAGAAGACACCCAAAGGTAGGG No data
1065522862_1065522867 -1 Left 1065522862 10:26588972-26588994 CCTGACAGCAGCACATTGGCCAC No data
Right 1065522867 10:26588994-26589016 CCAGAAGACACCCAAAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065522867 Original CRISPR CCAGAAGACACCCAAAGGTA GGG Intergenic
No off target data available for this crispr