ID: 1065527547

View in Genome Browser
Species Human (GRCh38)
Location 10:26638246-26638268
Sequence CCAGAAGACACCCAAAGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065527540_1065527547 18 Left 1065527540 10:26638205-26638227 CCAGTCTGATTCCGGAGCCGTGA No data
Right 1065527547 10:26638246-26638268 CCAGAAGACACCCAAAGGTAGGG No data
1065527539_1065527547 19 Left 1065527539 10:26638204-26638226 CCCAGTCTGATTCCGGAGCCGTG No data
Right 1065527547 10:26638246-26638268 CCAGAAGACACCCAAAGGTAGGG No data
1065527538_1065527547 23 Left 1065527538 10:26638200-26638222 CCTGCCCAGTCTGATTCCGGAGC No data
Right 1065527547 10:26638246-26638268 CCAGAAGACACCCAAAGGTAGGG No data
1065527541_1065527547 7 Left 1065527541 10:26638216-26638238 CCGGAGCCGTGACTTACAGCATA No data
Right 1065527547 10:26638246-26638268 CCAGAAGACACCCAAAGGTAGGG No data
1065527543_1065527547 1 Left 1065527543 10:26638222-26638244 CCGTGACTTACAGCATATTGGCT No data
Right 1065527547 10:26638246-26638268 CCAGAAGACACCCAAAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065527547 Original CRISPR CCAGAAGACACCCAAAGGTA GGG Intergenic
No off target data available for this crispr