ID: 1065527663

View in Genome Browser
Species Human (GRCh38)
Location 10:26639131-26639153
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065527663_1065527668 6 Left 1065527663 10:26639131-26639153 CCCTCCAAGTTCTGGTTATAACT No data
Right 1065527668 10:26639160-26639182 TCCTTAAACTGCACTATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065527663 Original CRISPR AGTTATAACCAGAACTTGGA GGG (reversed) Intergenic
No off target data available for this crispr