ID: 1065528170

View in Genome Browser
Species Human (GRCh38)
Location 10:26643300-26643322
Sequence ACCAAGGCCAGCCCCACTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 11, 3: 31, 4: 233}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065528167_1065528170 0 Left 1065528167 10:26643277-26643299 CCACGCTGACTTGTCGCATGTGC 0: 1
1: 0
2: 4
3: 11
4: 43
Right 1065528170 10:26643300-26643322 ACCAAGGCCAGCCCCACTCAGGG 0: 1
1: 0
2: 11
3: 31
4: 233
1065528166_1065528170 9 Left 1065528166 10:26643268-26643290 CCATGGGGACCACGCTGACTTGT 0: 1
1: 3
2: 4
3: 15
4: 96
Right 1065528170 10:26643300-26643322 ACCAAGGCCAGCCCCACTCAGGG 0: 1
1: 0
2: 11
3: 31
4: 233
1065528165_1065528170 10 Left 1065528165 10:26643267-26643289 CCCATGGGGACCACGCTGACTTG 0: 1
1: 3
2: 4
3: 14
4: 80
Right 1065528170 10:26643300-26643322 ACCAAGGCCAGCCCCACTCAGGG 0: 1
1: 0
2: 11
3: 31
4: 233
1065528164_1065528170 11 Left 1065528164 10:26643266-26643288 CCCCATGGGGACCACGCTGACTT 0: 1
1: 3
2: 3
3: 16
4: 130
Right 1065528170 10:26643300-26643322 ACCAAGGCCAGCCCCACTCAGGG 0: 1
1: 0
2: 11
3: 31
4: 233
1065528160_1065528170 30 Left 1065528160 10:26643247-26643269 CCTGAGAAGAGCAGAGGTGCCCC No data
Right 1065528170 10:26643300-26643322 ACCAAGGCCAGCCCCACTCAGGG 0: 1
1: 0
2: 11
3: 31
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065528170 Original CRISPR ACCAAGGCCAGCCCCACTCA GGG Intergenic
900555214 1:3276872-3276894 ACCAAGCCCAGCCCCCTTTAGGG - Intronic
901426141 1:9183155-9183177 GCCAAGCCCTGCCCCACGCAAGG - Intergenic
902422654 1:16293601-16293623 ACAAAGCCCAGCTCCACCCATGG + Intronic
902753431 1:18533311-18533333 ACCTAGCCCAAGCCCACTCAAGG + Intergenic
903283361 1:22262768-22262790 ACCAGGCCCGGCCCCACCCAGGG - Intergenic
903324659 1:22563203-22563225 ACCAGGACCAGACCCACCCAGGG - Intergenic
905324414 1:37140635-37140657 ACCAAGGCCAACCCAACTCAGGG - Intergenic
906074444 1:43041792-43041814 ACCAAGCCCAGCACCACTAGGGG - Intergenic
906509381 1:46402214-46402236 GCCAAGGCCAGCCCCTCCCTGGG + Intronic
908490603 1:64640166-64640188 ACTAAATCCAGCCACACTCAAGG + Intronic
914373873 1:147054869-147054891 GCCAAGCCTAGCCCCATTCAGGG - Intergenic
914914778 1:151812926-151812948 CCCAAGCCCAGCAACACTCACGG + Exonic
915018186 1:152756441-152756463 ACTCAGGCCACCTCCACTCATGG + Intronic
915403462 1:155641367-155641389 ACCACGCCCAGCCCCAATTAGGG + Intergenic
918521051 1:185415444-185415466 GACAAAGCCAGCCTCACTCAGGG - Intergenic
919126544 1:193401279-193401301 ACTAGGTCCAGCCACACTCAAGG - Intergenic
920509832 1:206542623-206542645 GCAAAGGCCAGCCCCTCCCATGG + Intronic
921872098 1:220152364-220152386 ACCACGCCCAGCCCCTCTAATGG + Intronic
922621038 1:226988359-226988381 ACCCAGGCCAGCCCCAGCCAGGG + Intergenic
922698619 1:227744885-227744907 ACAACTGTCAGCCCCACTCAGGG + Intronic
922782440 1:228263895-228263917 ACCAAGGGCTGCCCCAGGCAGGG - Intronic
924017423 1:239742604-239742626 CACACCGCCAGCCCCACTCAAGG + Intronic
924127425 1:240869648-240869670 ACCACGCCCAGCCTCATTCATGG - Intronic
1063378993 10:5572524-5572546 ACAGTGGCCAGCACCACTCAGGG + Intergenic
1064557201 10:16559380-16559402 GCCACAGCAAGCCCCACTCAAGG - Intergenic
1065521668 10:26579686-26579708 ACCAAAGCCAGCCCCAGGCAGGG + Intergenic
1065521698 10:26579822-26579844 CCCAATGCCAGCCCCAAGCAGGG + Intergenic
1065522037 10:26582530-26582552 ACCAAAGGCAGCCCCAATCAGGG + Intergenic
1065522263 10:26584404-26584426 ACCAAAGCCAGCCCCAGTCAGGG + Intergenic
1065522503 10:26586251-26586273 ACCAAAGCCAGCTCCAATCAGGG + Intergenic
1065522811 10:26588689-26588711 ACCAAAGCCAGCCCCAATCATGG + Intergenic
1065527491 10:26637950-26637972 ACCAAAGCCAGCCCAAGGCAGGG + Intergenic
1065527836 10:26640709-26640731 ACCAAAGCCAGCCCCAGTCAGGG + Intergenic
1065528170 10:26643300-26643322 ACCAAGGCCAGCCCCACTCAGGG + Intergenic
1065528530 10:26646152-26646174 ACCAAAGTCAGCCCCAGTCAGGG + Intergenic
1065528742 10:26647962-26647984 ACCAAAGCCAGCCCCAGTCAGGG + Intergenic
1065558482 10:26939585-26939607 ACCAAAGCCAGCCCCAGTCAGGG - Intergenic
1065558708 10:26941415-26941437 ACCAAAGCCAGCCCCAGTCAGGG - Intergenic
1065559063 10:26944232-26944254 ACCAAAGCCAGCCCCAGGCAGGG - Intergenic
1065559349 10:26946438-26946460 ACCAAAGCCAGCCCCAGGCAGGG - Intergenic
1069724180 10:70566813-70566835 TTCAAGGCCAGCACCCCTCAGGG - Exonic
1070061205 10:72984589-72984611 ACCACACCCAGCCCCACTTAAGG - Intergenic
1070948445 10:80411861-80411883 GCCCAGCCCAGCCCCACCCAGGG - Intronic
1070963831 10:80517463-80517485 ACCAAGGCCATCCCCAATTTTGG - Intronic
1071370397 10:84945385-84945407 TCCATGGCCAGGCCCAGTCATGG + Intergenic
1073097187 10:100987069-100987091 CCCGAGCCCGGCCCCACTCACGG + Exonic
1073490569 10:103850511-103850533 CCCAAGGTCAGCACCACACATGG - Intronic
1073512329 10:104050570-104050592 ACCAGGGCCTGCCTCACTCCTGG - Intronic
1076429268 10:130390246-130390268 TGCAAGGCCAGCCAGACTCAAGG - Intergenic
1076682471 10:132180315-132180337 ACCAAGGCCAGACCCATGGATGG + Intronic
1077101979 11:826388-826410 CCCAAGGGGAGCCCCAGTCAGGG + Intronic
1077150537 11:1071155-1071177 TCCAACCCCAGCCCCACACAGGG - Intergenic
1079085720 11:17443399-17443421 ACCAAGGCTTGTCCCACTCTAGG - Intronic
1079604380 11:22346337-22346359 AGCAAAGACAGCCCCACTCTTGG + Intronic
1081506413 11:43721668-43721690 CCCAAGCCCAGGCCCACCCATGG - Intronic
1082096761 11:48137315-48137337 TGCAAGGTCAGCACCACTCAGGG - Intronic
1083099894 11:60292269-60292291 ACCAGGGCCAGCCCCTGGCATGG - Exonic
1086662556 11:89438096-89438118 ACTAAGTCCAACACCACTCATGG + Intronic
1088038275 11:105344817-105344839 AACAAGGCCAGCCCCATTTCTGG - Intergenic
1091584653 12:1809250-1809272 GCCAAGGCCACCTCCACGCATGG - Intronic
1092063047 12:5566147-5566169 AGCAAGGCCAGCCCCTCTAGTGG - Intronic
1093818014 12:23573666-23573688 ATTAAGTCCAGCCCAACTCAAGG - Intronic
1094033251 12:26037950-26037972 ACCAAGGCCAGCTCAATTCTGGG + Intronic
1094048843 12:26196794-26196816 ACCCAGGCCAGACTCACCCAGGG + Intronic
1095096170 12:38150516-38150538 AGCAAAGCCAGCCTCACTCTAGG - Intergenic
1098284068 12:68890608-68890630 GCCAAAGCCAACCCCACTCTGGG + Intronic
1100717272 12:97319152-97319174 GCCCAGGCCAGCCCTACTGAAGG + Intergenic
1103338765 12:120210144-120210166 ACCAAGGGCATCCTCACTCACGG - Intergenic
1104915008 12:132260080-132260102 CCCAAAGCCAGCCCCACAGAGGG - Intronic
1109835965 13:67857884-67857906 ACCGTGGCAAGCCCCACCCAAGG + Intergenic
1111879873 13:93942911-93942933 AGCAAGGCCATCCCAACTGAGGG - Intronic
1113465886 13:110512637-110512659 AGCAGGGCCAGGCCCACCCACGG - Exonic
1113634347 13:111909646-111909668 AGCACCGCCAGCACCACTCACGG - Intergenic
1114208990 14:20599808-20599830 ACCAGGCCCAGCCCAACTTAAGG + Intronic
1118324410 14:64771658-64771680 CCCAGGGCCAGCCTCAATCAGGG - Intronic
1118819509 14:69335868-69335890 ACATCTGCCAGCCCCACTCAAGG - Intronic
1119515004 14:75240977-75240999 CCTAAGGCCAGCCTCACCCAGGG - Intronic
1121013200 14:90533847-90533869 TCCATAGTCAGCCCCACTCAGGG + Exonic
1121122828 14:91386818-91386840 ACCCAGGCTAGCCCCACTTTAGG + Intronic
1121626178 14:95386918-95386940 TCCTAAGCCAGCTCCACTCACGG - Intergenic
1202904254 14_GL000194v1_random:59479-59501 TCCCAGGCCAGGCCCCCTCAGGG + Intergenic
1123943769 15:25229198-25229220 ACCAACACCAACCCCACACAGGG - Intergenic
1126174666 15:45724424-45724446 ACTAGGTCCAGCCACACTCAAGG - Intergenic
1126230429 15:46317015-46317037 CCCAAGGCCAACCCTACTTAAGG + Intergenic
1126696391 15:51329508-51329530 AGCAAGGCCAGGGCCACTGATGG + Intronic
1126898452 15:53286033-53286055 ACCCGGGCCAAGCCCACTCAGGG + Intergenic
1129816714 15:78561759-78561781 ACCAAGCCCAGTCCCACCCTAGG - Intergenic
1129898130 15:79123621-79123643 CCCAAGGCCAGCCAGAATCAAGG + Intergenic
1130657079 15:85799202-85799224 GCCAAGCCCACTCCCACTCAGGG + Intergenic
1130758290 15:86789811-86789833 ACCAGGGCTAGCCCCAGGCAAGG - Intronic
1133296069 16:4752921-4752943 TCAGAGGCCAGCCCCAGTCAGGG - Exonic
1133763828 16:8821514-8821536 TGGAAGGCCAGCCCCACTCCAGG - Intronic
1134444361 16:14319717-14319739 AGCCAGGCCTGCCCCTCTCAGGG - Intergenic
1135564389 16:23500362-23500384 ACCAATGCCAGCCCCAGGTAGGG + Intronic
1138190287 16:55008995-55009017 GCCTAGGCCACCCCCACTTAGGG - Intergenic
1138558403 16:57786194-57786216 CACAAAGCCAGCCCCACACATGG + Intronic
1140332514 16:74071644-74071666 ACCAAGCCCAGCCACCCTCTTGG - Intergenic
1140809828 16:78566475-78566497 AGCAAGGCCAGCGACAATCAGGG - Intronic
1141713172 16:85711937-85711959 ACTAAGTCCATCCACACTCAAGG - Intronic
1147626173 17:41901643-41901665 AGGAAGGCCACCCACACTCAGGG + Intronic
1147654702 17:42082234-42082256 ACCAAGCCCAGCACCTCACAGGG + Intergenic
1148210294 17:45804525-45804547 ACCAGGGCCACCCCCTTTCACGG - Intronic
1152041709 17:77907794-77907816 ACCGAGCCCTTCCCCACTCAGGG - Intergenic
1152200055 17:78939997-78940019 TCCCAGGCCAGCCCCACTCTCGG - Intergenic
1152553373 17:81040802-81040824 GCCTAGGCCAGCCCCACACCAGG - Intronic
1152615916 17:81337705-81337727 ACCAAGGGTGGCCCCACGCAGGG + Intergenic
1153604114 18:6814251-6814273 AGGAAAGCCAGTCCCACTCAGGG + Intronic
1155573822 18:27223865-27223887 GCCACGGCAAGCCCCACCCAAGG - Intergenic
1155898222 18:31355165-31355187 ACTTATGCCAGCTCCACTCAGGG - Exonic
1157113318 18:44841450-44841472 ACTAAAGCCAGCCACACTCAAGG + Intronic
1159022539 18:63155447-63155469 ACCAAGCTCACCCCCACTAAGGG - Intronic
1160741610 19:688886-688908 ACCACGCCCGGCCCCACACAGGG + Intronic
1160983822 19:1828373-1828395 CCCAACGCCAGCCCCACTGTGGG - Exonic
1161811133 19:6472012-6472034 ACCAAGCCCTGCCCCTTTCAGGG + Intronic
1162575313 19:11495686-11495708 CCCAAGGCCAGTCCCAGGCAGGG - Intronic
1162788518 19:13051206-13051228 CCCTATACCAGCCCCACTCAGGG + Intronic
1163758483 19:19120586-19120608 TCCAAGGCAAGCCCCACTCCAGG + Intronic
925294298 2:2767471-2767493 ACCAAGCCCAGCTCCTCTCCTGG + Intergenic
925687838 2:6491706-6491728 GCCACGGCAAGCCCCACGCAAGG + Intergenic
928007660 2:27578159-27578181 ACCAAGGCCAACCCCTCAAATGG + Exonic
931178677 2:59878147-59878169 TCCAAGGTCAGGGCCACTCAAGG - Intergenic
932306321 2:70706205-70706227 GCCCGGGTCAGCCCCACTCACGG + Exonic
933058562 2:77705150-77705172 TCTAAGGCCAGCCCAAATCAAGG - Intergenic
933433457 2:82214684-82214706 GCCAAAGCAAGCCCCACCCAAGG - Intergenic
934573390 2:95385545-95385567 AGCCAGCCCAGCTCCACTCAGGG + Exonic
935196053 2:100817561-100817583 GCCAAGCCCAGCCTGACTCATGG + Intergenic
935268133 2:101411849-101411871 ACCAAGGCCAGCCCTACTTCAGG + Intronic
935414810 2:102804065-102804087 ACCTTGGCCAGCCCCTCCCAGGG - Intronic
935802188 2:106708665-106708687 ACCAAGAGCAACCCTACTCAGGG - Intergenic
936286170 2:111182997-111183019 GCCAGGCCCAGCCCCACTCTTGG + Intergenic
937291668 2:120785631-120785653 CCCAAGCCCAGCACCACCCATGG + Intronic
937427411 2:121811871-121811893 CCCAAGGCCAGACCCACAAAGGG - Intergenic
937911935 2:127080053-127080075 GCCAAGGCCAGCCTCGCCCATGG - Intronic
937994029 2:127679694-127679716 ACCAAGCCCAGCCCCTCTCTTGG - Intronic
938078037 2:128351652-128351674 CTCAAGTCCAGCCACACTCAAGG - Intergenic
941289363 2:163656492-163656514 ACCAAGGCAGGCCACACTCCTGG + Intronic
941609338 2:167641697-167641719 ACCAAGGCCAGTCCCATTACAGG - Intergenic
942530160 2:176901414-176901436 ACCAATGGCAGTGCCACTCATGG + Intergenic
945536644 2:211026103-211026125 GCCACAGCAAGCCCCACTCAAGG - Intergenic
945665551 2:212736979-212737001 ACCAAAGGTAACCCCACTCAGGG - Intergenic
945953723 2:216065738-216065760 ACAGAGGCCTGCCCTACTCAAGG - Intronic
946042622 2:216795663-216795685 ACCAACCCCAGACCCACTCTAGG - Intergenic
946219904 2:218217361-218217383 ACCCCACCCAGCCCCACTCAGGG + Exonic
948136547 2:235640628-235640650 AGGGAGGCCAGCCCCATTCATGG - Intronic
1168830971 20:845165-845187 GCCGAGGCCAGCCGCACTCCTGG + Exonic
1170906076 20:20516166-20516188 GCCATGGCTGGCCCCACTCAAGG + Intronic
1171142618 20:22755973-22755995 ACAAAGGCCAGCCCCTCGCAAGG - Intergenic
1171511231 20:25686281-25686303 ACCAAGGCCAGCACCGCTCCTGG - Intronic
1171725842 20:28620402-28620424 ACCAAAGCCAGCCCCCGGCAGGG + Intergenic
1171725872 20:28620538-28620560 CCCAATGCCAGCCCCAAGCAGGG + Intergenic
1171790046 20:29514898-29514920 ACCAAAGCCAGCCCCAGGCAGGG + Intergenic
1171935659 20:31272683-31272705 ACCAAGGACCATCCCACTCAGGG + Intergenic
1174342432 20:49906262-49906284 ACCATGGCCAGCTCCCCCCACGG - Exonic
1174375606 20:50124717-50124739 CCCAACGCCAGCCACACTGAAGG + Exonic
1175130160 20:56782642-56782664 CCCAAGGCCATCCCCAGCCAAGG - Intergenic
1175827019 20:61941944-61941966 GCCAAGGTGAGCCCCACTGAGGG - Intergenic
1176208990 20:63908206-63908228 ACCAGGGACAGCCCCACGCATGG + Intronic
1176239514 20:64069490-64069512 GCCAGGGCCGGCCGCACTCACGG - Exonic
1176623625 21:9074246-9074268 TCCCAGGCCAGGCCCCCTCAGGG + Intergenic
1180019898 21:45116247-45116269 ACCCAGGCCAGCCCCACCCTGGG - Intronic
1180390745 22:12280008-12280030 ACCAAAGCCAGCCCCCGGCAGGG + Intergenic
1180408997 22:12584749-12584771 ACCAAAGCCAGCCCCCGGCAGGG - Intergenic
1181035683 22:20168761-20168783 AGCCAGGCCAACCCCACGCAGGG - Intergenic
1181063377 22:20292973-20292995 ACCAGGGCCTGCCACTCTCAAGG - Intergenic
1181083262 22:20427642-20427664 ACCAAGACCAGCCCTATTCTTGG + Intronic
1181404600 22:22673732-22673754 ACCCAGGCCAGCCCTGCTCATGG - Intergenic
1181471772 22:23145192-23145214 TCCACGGTCAGCCCCACCCAGGG + Intergenic
1181475825 22:23167262-23167284 ACCAAGCTCAGCCCTCCTCAGGG + Intergenic
1181483058 22:23213213-23213235 ACCAAGGACAGCCAAGCTCAGGG - Intronic
1182869017 22:33629598-33629620 TCCAACCCCTGCCCCACTCATGG - Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1183640202 22:39088134-39088156 ACCCAGGACAGGCCCAGTCAGGG + Intergenic
1184295177 22:43518859-43518881 ACTAGGTCCAGCTCCACTCAAGG + Intergenic
1184689067 22:46109293-46109315 AGGAAGGCCAGCCCCAGGCAGGG - Intronic
1184990644 22:48167153-48167175 ACCATGGCCTGCCCCCTTCACGG - Intergenic
949516890 3:4815370-4815392 GCCAAGGAGAGCCTCACTCACGG - Intronic
950450851 3:13064569-13064591 ACCAAGGACAGCATCTCTCATGG - Intronic
951243497 3:20314055-20314077 ATCCAGGCAAGTCCCACTCACGG - Intergenic
953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG + Intronic
954316114 3:49802862-49802884 GCCAAGGCCAGCCTCACGAATGG + Intergenic
954447154 3:50552953-50552975 CCCATGGACAGCCCCTCTCAGGG + Intergenic
956030863 3:65036328-65036350 AACAATGACAGCACCACTCATGG - Intergenic
957959783 3:87234477-87234499 ACCCAGGCCGGCTCCACTCTGGG - Intronic
961357649 3:126349271-126349293 ACCAGGGCCAGACCCACTCCAGG + Intronic
961817898 3:129560632-129560654 GCCAAGGCCACACCCACTGAGGG + Intronic
963482856 3:145898735-145898757 TCCAAGGCAAGCCCCTGTCACGG - Intergenic
968911015 4:3477018-3477040 ACTCAGGCCATCCCCACCCACGG - Intronic
968918651 4:3510919-3510941 ACCATGACCAGCCACACCCATGG + Exonic
969104128 4:4792016-4792038 GCCAAAGCCAGCTCCACACAGGG - Intergenic
969478557 4:7434815-7434837 ACCAGGGCCAGCCCCACCTCAGG - Exonic
969755848 4:9150160-9150182 ACCACGCCCAGCCTCACTAAAGG - Intergenic
969959845 4:10933355-10933377 ACCAAGGCCAACCCTATTTAAGG + Intergenic
970160382 4:13182297-13182319 ACTAAGTCCAGCCACACTCAAGG - Intergenic
972967499 4:44529491-44529513 ACTAAGTCCAGCCACACTCATGG - Intergenic
974224167 4:59017867-59017889 ACCCAGTGCAGCCCCAGTCATGG - Intergenic
975132007 4:70840011-70840033 ACCATGGGCAGCCCCGCCCAAGG - Intergenic
975537791 4:75470406-75470428 ATCAAGGCCATATCCACTCAAGG + Intergenic
981027834 4:140094459-140094481 ACCATGGCCAGCCACACACAGGG + Intronic
985434714 4:189917393-189917415 ACCAAAGCCAGCCCCCGGCAGGG - Intergenic
985711710 5:1433156-1433178 ACCCAGGGCAACCCAACTCATGG + Intronic
985920337 5:2966557-2966579 ATCCAGCCCAGCCCCACCCAGGG + Intergenic
985927058 5:3026948-3026970 GCCAAGGCCTGCACCTCTCAGGG - Intergenic
991543220 5:67752388-67752410 GCCATGGCAAGCCCCACCCAAGG + Intergenic
991566722 5:68012497-68012519 AGAAAGGCCATCCACACTCAGGG - Intergenic
991978352 5:72205242-72205264 ACCAAGGCCAGCCACACCACAGG + Exonic
992320728 5:75611408-75611430 TCCCAGGCCAGCCCAAGTCAGGG + Intergenic
995478243 5:112569454-112569476 ACCACTGTCAGTCCCACTCACGG + Intergenic
997738413 5:136231970-136231992 AACCAGCCCAGCCCCACTCCAGG - Intronic
998218047 5:140252420-140252442 ACCAAGGCAGGTCACACTCAGGG - Intronic
999240406 5:150124377-150124399 CCCCAGGCCAGGCCCAGTCATGG + Intronic
999284379 5:150385513-150385535 ATCTAGGCCAGCCCCACTCCAGG - Intronic
1001405989 5:171478025-171478047 GCCAAGCCCAGCCCCACTTCAGG + Intergenic
1001870596 5:175151055-175151077 ACCACGCCCAGCCCCACTCCTGG + Intergenic
1004275802 6:14234090-14234112 ACCAAGGCAAGTGCCACACAAGG + Intergenic
1006794399 6:36722491-36722513 AACAAGGCCCGCCTCACTCCAGG + Exonic
1007472786 6:42101780-42101802 ACCAAGGCCAGCCACCCTGATGG - Exonic
1012556681 6:100521930-100521952 ACCAAAGCCATCCCCAGTCTGGG - Intronic
1014428776 6:121341470-121341492 ACCAAGCCCAGCCTAACGCAAGG + Intergenic
1017606672 6:156142180-156142202 CCTGAGGCCAGCCCCAGTCATGG - Intergenic
1018393705 6:163360711-163360733 ACTAAGTCCAGCCACCCTCAGGG + Intergenic
1018779208 6:167046737-167046759 ACCAAGGCCAGGCCCTCTCAGGG + Exonic
1019622893 7:2001239-2001261 ACCCAGGCCAGCCTGACGCATGG + Intronic
1019634712 7:2069391-2069413 ACCAAGCCCCGCCCCACCCCAGG + Intronic
1019930360 7:4218729-4218751 ACCAAGGGCAGCTCTTCTCAGGG + Intronic
1022302687 7:29115854-29115876 CCCAAGACCAGCACCACACAGGG + Intronic
1023041920 7:36179966-36179988 ACCCACCCCGGCCCCACTCAGGG - Intronic
1023848242 7:44135432-44135454 ACCCAGGCCAGGACCACACAGGG + Intergenic
1023896745 7:44440062-44440084 ACTAAGTCCAGCCCCACTGAAGG - Intronic
1024100223 7:46024775-46024797 ACTAAGTCCAGCCCCACTCAAGG + Intergenic
1030117063 7:106070098-106070120 ACCATGGCCAGCCACACCCCAGG - Intergenic
1034223328 7:149461553-149461575 TCCAAGACCAGCTCCACTCCTGG - Intergenic
1034557037 7:151856708-151856730 AACAAGACCAGCCACACACACGG + Intronic
1034948347 7:155279123-155279145 CCCACGGCGAGCCCCACCCATGG + Intergenic
1035692159 8:1567354-1567376 TCCAAGGCCAGCCTCAGTCCTGG + Intronic
1039440839 8:37594348-37594370 GCCAAGGCCAGGCCTACTCTGGG + Intergenic
1040671065 8:49691331-49691353 ACCACAGCAAACCCCACTCAAGG - Intergenic
1041225034 8:55689571-55689593 ACCCAGGCCAGCACCACTCAGGG + Intergenic
1042162735 8:65913105-65913127 ACCCAGGACAGTCCCAGTCATGG + Intergenic
1042254345 8:66787999-66788021 AGAAAAGGCAGCCCCACTCAGGG - Intronic
1042718820 8:71804961-71804983 ACCAAGGCCCGCGCCACCCCCGG - Intergenic
1047042309 8:121009540-121009562 ACCAAGGCAAACCCCATTCTTGG + Intergenic
1049083904 8:140463174-140463196 ACAAAAGCCAGCACCTCTCAAGG + Intergenic
1049640409 8:143712640-143712662 ACCCAGGCCAGATCCACACAAGG + Intronic
1049807494 8:144547551-144547573 ACCAGCGCCACCCCCACTGAGGG - Exonic
1051124841 9:13792121-13792143 ACAAAAGGCAGCCCCAGTCAGGG + Intergenic
1053723769 9:40975466-40975488 ACCAAAGCCAGCCCCCAGCAGGG - Intergenic
1054342190 9:63876533-63876555 ACCAAAGCCAGCCCCCAGCAGGG + Intergenic
1055182275 9:73402507-73402529 GCCAGGGCCGGCCCCACCCAAGG - Intergenic
1055355790 9:75435859-75435881 ACCAAGGACAGCCCTACTTAGGG - Intergenic
1056119935 9:83477592-83477614 ACCAAGGCCGTCCCAAATCAAGG + Intronic
1056759047 9:89402056-89402078 ACCACACCCAGCCCCACTCATGG - Intronic
1057010978 9:91601056-91601078 ACCAAGGCCAGGTCCTCTCTTGG + Intronic
1057044332 9:91873290-91873312 ACCATGCCCAGCCCCACTGGTGG - Intronic
1057186954 9:93062424-93062446 ACCAAGGGCAGCCACAACCATGG + Intronic
1057307462 9:93920574-93920596 ACCAAGACCCTCCCCAGTCAAGG - Intergenic
1057795133 9:98150408-98150430 ACCAAACCCATTCCCACTCAGGG + Intronic
1058813763 9:108665524-108665546 ACTAATGCCAGCCTTACTCATGG + Intergenic
1058915350 9:109559491-109559513 ACCAAATCCAGCCTCACTGAGGG + Intergenic
1061014407 9:127973602-127973624 ACCAAGGCCAGGCACAGTCACGG + Intronic
1061923449 9:133794655-133794677 ACCTCTGCCAGCCCCCCTCAGGG - Intronic
1062334639 9:136059671-136059693 ACCAAGGCCAGCCGTATGCAGGG - Intronic
1062451202 9:136616511-136616533 AGCCAGGCCAGCCCCTCACACGG - Intergenic
1203746809 Un_GL000218v1:44674-44696 TCCCAGGCCAGGCCCCCTCAGGG + Intergenic
1203451392 Un_GL000219v1:120532-120554 ACCAAAGCCAGCCCCCGGCAGGG + Intergenic
1203563298 Un_KI270744v1:74806-74828 TCCCAGGCCAGGCCCCCTCAGGG - Intergenic
1189160259 X:38803635-38803657 ACCAAGGCCAGGGCCACTGCGGG + Exonic
1189733257 X:44044081-44044103 ACAAAGTCCAGCCCCACTCAAGG + Intergenic
1192853002 X:74977568-74977590 GCCATAGCAAGCCCCACTCAAGG - Intergenic
1192895697 X:75440830-75440852 ACCATAGCAAGCCCCACACAAGG - Intronic
1192994561 X:76498984-76499006 ACCACAGCAAGCCCCACCCAAGG - Intergenic
1197318912 X:125003861-125003883 ACAATGGCCCGACCCACTCAAGG - Intergenic
1197603732 X:128560612-128560634 ACCAAGGCAAGCCCCTCGCAGGG + Intergenic
1199017709 X:142837852-142837874 CCCAAGACAAACCCCACTCAGGG - Intergenic
1199059618 X:143339506-143339528 ACCACAGCCAGCCCCTCCCATGG + Intergenic
1199214335 X:145248716-145248738 AGCAAGGGTAGCCCCACTGAAGG + Intronic
1201160136 Y:11159688-11159710 TCCCAGGCCAGGCCCCCTCAGGG + Intergenic