ID: 1065529317

View in Genome Browser
Species Human (GRCh38)
Location 10:26652903-26652925
Sequence AGGCGGGAGGATCGCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065529310_1065529317 25 Left 1065529310 10:26652855-26652877 CCACTGGGGCTCTTTTGTCAAGA No data
Right 1065529317 10:26652903-26652925 AGGCGGGAGGATCGCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065529317 Original CRISPR AGGCGGGAGGATCGCTCAGG AGG Intergenic