ID: 1065530064

View in Genome Browser
Species Human (GRCh38)
Location 10:26660432-26660454
Sequence ATAGCAAGGATGCCGTATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065530064_1065530066 -3 Left 1065530064 10:26660432-26660454 CCTGTATACGGCATCCTTGCTAT No data
Right 1065530066 10:26660452-26660474 TATAACTGCTTATTAGTTCCAGG No data
1065530064_1065530069 20 Left 1065530064 10:26660432-26660454 CCTGTATACGGCATCCTTGCTAT No data
Right 1065530069 10:26660475-26660497 AGTTTTTTGGTCAGTTATCCTGG No data
1065530064_1065530067 7 Left 1065530064 10:26660432-26660454 CCTGTATACGGCATCCTTGCTAT No data
Right 1065530067 10:26660462-26660484 TATTAGTTCCAGGAGTTTTTTGG No data
1065530064_1065530070 23 Left 1065530064 10:26660432-26660454 CCTGTATACGGCATCCTTGCTAT No data
Right 1065530070 10:26660478-26660500 TTTTTGGTCAGTTATCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065530064 Original CRISPR ATAGCAAGGATGCCGTATAC AGG (reversed) Intergenic
No off target data available for this crispr