ID: 1065530065

View in Genome Browser
Species Human (GRCh38)
Location 10:26660446-26660468
Sequence ACTAATAAGCAGTTATAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065530065_1065530069 6 Left 1065530065 10:26660446-26660468 CCTTGCTATAACTGCTTATTAGT No data
Right 1065530069 10:26660475-26660497 AGTTTTTTGGTCAGTTATCCTGG No data
1065530065_1065530070 9 Left 1065530065 10:26660446-26660468 CCTTGCTATAACTGCTTATTAGT No data
Right 1065530070 10:26660478-26660500 TTTTTGGTCAGTTATCCTGGTGG No data
1065530065_1065530067 -7 Left 1065530065 10:26660446-26660468 CCTTGCTATAACTGCTTATTAGT No data
Right 1065530067 10:26660462-26660484 TATTAGTTCCAGGAGTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065530065 Original CRISPR ACTAATAAGCAGTTATAGCA AGG (reversed) Intergenic
No off target data available for this crispr