ID: 1065530067

View in Genome Browser
Species Human (GRCh38)
Location 10:26660462-26660484
Sequence TATTAGTTCCAGGAGTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065530065_1065530067 -7 Left 1065530065 10:26660446-26660468 CCTTGCTATAACTGCTTATTAGT No data
Right 1065530067 10:26660462-26660484 TATTAGTTCCAGGAGTTTTTTGG No data
1065530064_1065530067 7 Left 1065530064 10:26660432-26660454 CCTGTATACGGCATCCTTGCTAT No data
Right 1065530067 10:26660462-26660484 TATTAGTTCCAGGAGTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065530067 Original CRISPR TATTAGTTCCAGGAGTTTTT TGG Intergenic
No off target data available for this crispr