ID: 1065530070

View in Genome Browser
Species Human (GRCh38)
Location 10:26660478-26660500
Sequence TTTTTGGTCAGTTATCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065530064_1065530070 23 Left 1065530064 10:26660432-26660454 CCTGTATACGGCATCCTTGCTAT No data
Right 1065530070 10:26660478-26660500 TTTTTGGTCAGTTATCCTGGTGG No data
1065530065_1065530070 9 Left 1065530065 10:26660446-26660468 CCTTGCTATAACTGCTTATTAGT No data
Right 1065530070 10:26660478-26660500 TTTTTGGTCAGTTATCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065530070 Original CRISPR TTTTTGGTCAGTTATCCTGG TGG Intergenic
No off target data available for this crispr