ID: 1065539743

View in Genome Browser
Species Human (GRCh38)
Location 10:26750936-26750958
Sequence CCTAATTGAAACCTTAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065539741_1065539743 9 Left 1065539741 10:26750904-26750926 CCTGATAATTTCTCTTGTGTTTT 0: 1
1: 1
2: 16
3: 511
4: 6787
Right 1065539743 10:26750936-26750958 CCTAATTGAAACCTTAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065539743 Original CRISPR CCTAATTGAAACCTTAATTG AGG Intronic
No off target data available for this crispr