ID: 1065540038

View in Genome Browser
Species Human (GRCh38)
Location 10:26754767-26754789
Sequence TATGCTAGAAAAGCTGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065540038_1065540039 -3 Left 1065540038 10:26754767-26754789 CCATCAACAGCTTTTCTAGCATA 0: 1
1: 0
2: 1
3: 15
4: 162
Right 1065540039 10:26754787-26754809 ATATTATAATTCAGTAATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065540038 Original CRISPR TATGCTAGAAAAGCTGTTGA TGG (reversed) Intronic
900031896 1:378516-378538 TATGCTACAAAGGGTCTTGAAGG + Intergenic
900052444 1:606707-606729 TATGCTACAAAGGGTCTTGAAGG + Intergenic
908061420 1:60354115-60354137 TATGCTAGAGCACCTGTTGGTGG - Intergenic
910511303 1:88008498-88008520 AAAGCTAGAGAAGCTTTTGAGGG - Intergenic
910594376 1:88963394-88963416 TATGCCAGACAAGATGTTTAAGG - Intronic
910934815 1:92479165-92479187 TTTGGTAGAAAAAGTGTTGAAGG - Intronic
911577767 1:99598572-99598594 TATGCAATAAAATCTGTTGAAGG - Intergenic
915759456 1:158295872-158295894 TATGCCAGCAAAGCAGTTGTGGG - Intergenic
917683330 1:177390665-177390687 TATGCCTGTAAAGTTGTTGATGG - Intergenic
917964786 1:180171657-180171679 TCTGTTTAAAAAGCTGTTGAAGG - Intronic
919565391 1:199179094-199179116 AAGTCTAGAAAAGCTCTTGAAGG + Intergenic
920317491 1:205088332-205088354 TATCCTAGGAAAGCTTTTGTTGG - Exonic
1063065190 10:2600901-2600923 TATACTATAAAACCTGTTTAAGG + Intergenic
1064067913 10:12199365-12199387 TATTTTAGAAAGGCTGGTGAGGG - Intronic
1065540038 10:26754767-26754789 TATGCTAGAAAAGCTGTTGATGG - Intronic
1065815308 10:29477773-29477795 TCTGCTGGAAAAGATGTTGTTGG + Intronic
1066093415 10:32049127-32049149 AATGGTTGAAAAGCTGTTGCAGG - Intronic
1066219118 10:33318472-33318494 TTTGCTAGAACAGCTGAAGAGGG + Intronic
1067107289 10:43374691-43374713 TTTGCTAGACAAGTTGGTGAGGG + Intronic
1069048031 10:63763518-63763540 TATCCTAGAAAAGTTGATTATGG + Intergenic
1074627190 10:115203303-115203325 TTTGCCATATAAGCTGTTGAAGG + Intronic
1078183054 11:9028595-9028617 TGTGCAAGAGAAGATGTTGAAGG + Intronic
1079406889 11:20155817-20155839 TATGGTAGGAAACCTGTTTATGG - Intergenic
1079728139 11:23903114-23903136 CATGATAGAAATACTGTTGAGGG + Intergenic
1081394926 11:42575420-42575442 TATTCTAGAAAAGATGGTCATGG + Intergenic
1082031279 11:47605960-47605982 TATTCTAGAATAGATTTTGAGGG + Intergenic
1088623437 11:111710095-111710117 TTTGATTGAAAAGCTATTGATGG + Intronic
1088793470 11:113247439-113247461 CATGCGAGACCAGCTGTTGACGG - Intronic
1089027137 11:115283032-115283054 AAAGCTATAAAAGCTGTTCATGG - Intronic
1089832617 11:121341909-121341931 TATGCTTAAAAATTTGTTGAGGG + Intergenic
1091545531 12:1499188-1499210 TCTGCCAGAAAAGCAGGTGAAGG - Intergenic
1091866710 12:3844322-3844344 TAAACTAGAATAGTTGTTGAAGG + Intronic
1093294040 12:17365996-17366018 TAAGGGAGAGAAGCTGTTGAAGG - Intergenic
1093360680 12:18223217-18223239 TATGCTAAGAAAATTGTTGAGGG - Intronic
1095596810 12:43968613-43968635 TCAGCTTGAAAAGCTGCTGAAGG + Intronic
1095750115 12:45701043-45701065 TATGTTAGAAAAACTGTTGTAGG + Intergenic
1097836598 12:64279381-64279403 TATGGTTGAAAAGCAGCTGAAGG + Intronic
1098602836 12:72353366-72353388 TATGGAAGAAAAGTGGTTGAAGG + Intronic
1098812257 12:75109674-75109696 TATGCTAGACAAGCAGGGGAGGG - Intronic
1099566125 12:84248732-84248754 TATGGTAATAAAGCTGTTGTTGG - Intergenic
1099742009 12:86650339-86650361 TATGCTAGAAACTCTGTTATGGG + Intronic
1099949509 12:89285364-89285386 TATGCTAGACAATGTGTTGGTGG - Intergenic
1102064588 12:109963294-109963316 GTTGCTAGACAAGATGTTGAAGG + Intronic
1103897556 12:124283508-124283530 TAGGCTAGAAAAACAGTTGTAGG + Intronic
1105774935 13:23650101-23650123 TATGCCAGAAGAGCTGTTTGGGG - Intronic
1108688853 13:52845543-52845565 TCTGCCAGAAATGGTGTTGAAGG + Exonic
1110505827 13:76284979-76285001 AATTCTAGAAAGGCTGTTTATGG + Intergenic
1111512354 13:89282849-89282871 TACCTTAGAAAAGCTGTTAAAGG - Intergenic
1111519579 13:89383155-89383177 GATGCTTGAGAAGCTGTTGTAGG - Intergenic
1112117331 13:96370473-96370495 TAAGCTAGATAATGTGTTGATGG - Intronic
1112382324 13:98903740-98903762 TATCCTTGTAAATCTGTTGATGG - Intronic
1114554707 14:23555402-23555424 GAGGCTAGAAATGCAGTTGAGGG - Intronic
1114879453 14:26765983-26766005 TAGGTTAGAAAACCTCTTGATGG - Intergenic
1116356396 14:43936730-43936752 TATCCTATAAAAGCAGTTGGGGG - Intergenic
1119936790 14:78599313-78599335 TATGCTGGCAAAGCTATTGAGGG + Intronic
1121186124 14:91971440-91971462 TAGGATACAAAAGCTGGTGATGG - Intronic
1123830008 15:24126021-24126043 TATGCAAGACATGATGTTGATGG - Intergenic
1124919500 15:34012154-34012176 TTTACTAGAAAAGTTGTTGATGG - Intronic
1124934291 15:34155746-34155768 TATACTAGAGATGCTGTTAAAGG - Intronic
1127460412 15:59193550-59193572 TGTCCTAGAGAAACTGTTGACGG + Intronic
1128897826 15:71391918-71391940 AAATCTAGAAATGCTGTTGAGGG - Intronic
1134163594 16:11912961-11912983 CATGCCGGGAAAGCTGTTGAAGG - Intronic
1134352758 16:13453186-13453208 GATGCTAGAAAAGCTATACAAGG - Intergenic
1134513954 16:14871804-14871826 TTATCTAGAAATGCTGTTGAAGG - Intronic
1134701596 16:16270303-16270325 TTATCTAGAAATGCTGTTGAAGG - Intronic
1134970234 16:18524347-18524369 TTATCTAGAAATGCTGTTGAAGG + Intronic
1139411407 16:66764002-66764024 TATGGGAGAAAAGCTGGGGATGG + Intronic
1140217141 16:73017664-73017686 TAAGCTAGCAAAGCTCTTGGTGG - Intronic
1141341226 16:83205540-83205562 AATGCAAGAAAAGAAGTTGAGGG + Intronic
1149229962 17:54521438-54521460 AATGCTAGAAACTCTTTTGACGG - Intergenic
1149535290 17:57429052-57429074 TATGCTGGGAAAGGTCTTGAGGG - Intronic
1152947760 17:83207198-83207220 TATGCTACAAAGGGTCTTGAAGG - Intergenic
1153434245 18:5052049-5052071 TCTGCTGGGCAAGCTGTTGATGG + Intergenic
1155192005 18:23438502-23438524 CATGCAAGAAAACCTATTGATGG + Intergenic
1156506332 18:37597076-37597098 TGGGCTAGAAAAGCTGATGGAGG - Intergenic
1158862880 18:61610285-61610307 CATTCTAGCAAAGATGTTGATGG + Intergenic
1161182153 19:2891082-2891104 GATGCAAGAAGAGCTGTGGATGG - Intergenic
929239514 2:39639593-39639615 GATTCTAGAAAAGCAGTTAAGGG + Intergenic
929329021 2:40656967-40656989 TAAGCTGTAAAAGCTGGTGAAGG - Intergenic
931751615 2:65335316-65335338 GTTGATATAAAAGCTGTTGAAGG - Intronic
931872804 2:66479401-66479423 TATGCTGGAAAAGCTTTTTATGG + Intronic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932873503 2:75427258-75427280 TATACTAGAGAAGCTATTGATGG + Intergenic
935328498 2:101959661-101959683 TTTGCAAGAAAAGCTGTTAATGG - Intergenic
938036908 2:128042331-128042353 TATACTAGAGATGCTGTTAAAGG + Intergenic
939431972 2:142121193-142121215 CATCCTGGAAAAGATGTTGATGG - Intronic
939797425 2:146663672-146663694 TATGCTATTAATGCTGTTGATGG + Intergenic
940562583 2:155319277-155319299 TGTGATAGAAAAGATATTGATGG + Intergenic
943403970 2:187455849-187455871 TCTGCTACAAAGGCTGTTGCAGG + Intergenic
944455299 2:199887453-199887475 AATGCAAGAAAAGGTGTTGGAGG + Intergenic
945592569 2:211752730-211752752 GTTGCTAGAAATACTGTTGACGG + Intronic
946287837 2:218718676-218718698 TATGTTAGAAAATCTATTGCTGG - Intronic
946457958 2:219844291-219844313 AATGCTTGAAAAGCTGGAGAGGG + Intergenic
947787329 2:232835402-232835424 TATGTTATAAAAGTTGTTCAGGG - Intronic
1170113591 20:12832181-12832203 TAAGCAAGAAAAGCAGTTGAAGG - Intergenic
1173082595 20:39883161-39883183 TATGCCAGCAAAGCTTCTGAGGG + Intergenic
1173636905 20:44567625-44567647 GTAGCTAGAAAAGCCGTTGAAGG - Intronic
1182191597 22:28466740-28466762 TATGCTAGAAAAGTAGTGAAGGG - Intronic
951584113 3:24197796-24197818 TATGCTACAGTATCTGTTGATGG - Intronic
953780571 3:45866511-45866533 TATGCTGGAAAAGCAATTGTGGG + Intronic
957617099 3:82543849-82543871 TATGGTAAAAAATCTGTTGGAGG - Intergenic
960871140 3:122251146-122251168 TCTGCTAGGAATGCTGTTGGAGG + Intronic
964212258 3:154241529-154241551 TATTCAAGAAAAGTTATTGAAGG + Intronic
964296348 3:155238431-155238453 AATGCAAGAAAAAATGTTGAAGG - Intergenic
965451845 3:168847723-168847745 CCTGCTAGCAAAGCTCTTGATGG - Intergenic
967453524 3:189653317-189653339 TGTGCTAGTCAGGCTGTTGAAGG - Intronic
968293807 3:197557993-197558015 TTTGCTAGAAAAGTAGTTAAAGG + Intronic
968797338 4:2716322-2716344 CATGCTAGAAAAATAGTTGATGG + Intronic
971563885 4:28115195-28115217 GATGCTAGAAGATCTGATGAGGG - Intergenic
972412095 4:38805690-38805712 TGTGGTAGAAAAGCTGATTACGG - Intronic
973019491 4:45184546-45184568 TAAACTTGAAAAGATGTTGATGG - Intergenic
978672319 4:111264659-111264681 TATGGTAGGAAAGCTGGTAAGGG - Intergenic
983717009 4:170795075-170795097 GATGCTAGAAAAGTAGTTAAAGG + Intergenic
986523253 5:8643929-8643951 TATGCAAGAAAATATGTTTATGG - Intergenic
987498552 5:18675207-18675229 TATGGTAGATAAGCTGATGAAGG - Intergenic
987750520 5:22032973-22032995 TATTTTAGAAAAGCTTTTGGGGG - Intronic
988143592 5:27274923-27274945 TATGTTAGAAAAGATTTTAAAGG - Intergenic
988527303 5:31998447-31998469 AGTGAGAGAAAAGCTGTTGAAGG + Intronic
988533929 5:32049459-32049481 CATGCTTGGAAAGCTGTAGAGGG + Intronic
994671896 5:102771854-102771876 TATGCTAGAAGGGCTGTGGCTGG + Intronic
995945162 5:117636265-117636287 GATGTTAGAAAGGCTTTTGAGGG - Intergenic
996174852 5:120343649-120343671 TATACAAGAAAATCTGCTGAAGG + Intergenic
996663791 5:126034589-126034611 TAATCTAGAAAAGATGTTAATGG + Intergenic
1002741924 5:181440352-181440374 TATGCTACAAAGGGTCTTGAAGG - Intergenic
1002797895 6:490200-490222 TATTCTAGGCAAGCTTTTGAGGG - Intronic
1002956281 6:1868283-1868305 GATGACAGAACAGCTGTTGAGGG - Intronic
1003997242 6:11555040-11555062 TATGCTACAAAATATATTGAAGG - Intronic
1004017507 6:11745627-11745649 AATGTCACAAAAGCTGTTGAAGG - Intronic
1005783764 6:29220775-29220797 TATGCAAGAAAATATGTGGAAGG + Intergenic
1006950437 6:37818159-37818181 TATGCCACAGATGCTGTTGATGG - Intergenic
1010042042 6:71396362-71396384 TAAGCTAGAAAAGTTGTGGAAGG - Intergenic
1010392492 6:75353654-75353676 CATGCTAGAGCAGCTGTTGCTGG - Exonic
1011301954 6:85884949-85884971 TATTCAAGAAAAGCTATTTAAGG - Intergenic
1012019473 6:93899385-93899407 TATCCTAGCACAGTTGTTGAAGG - Intergenic
1012878207 6:104754503-104754525 AATGAAAGAAAAGCTGTTAAGGG + Intronic
1013030887 6:106331593-106331615 TGTGAAAGAAAAGCTCTTGATGG + Intergenic
1015546702 6:134368895-134368917 TTTGCCATAAAAGCTGTTGGAGG + Intergenic
1016521424 6:144951052-144951074 GATGCTAGAAAAGTTGTTGAAGG - Intergenic
1017498017 6:154998252-154998274 TATGCGAGCAAAGCTCTTTAGGG - Intronic
1018191216 6:161310678-161310700 TACACTAGAGATGCTGTTGAAGG - Intergenic
1018270654 6:162073750-162073772 TATGTTTTAAAAGCTGTAGAGGG - Intronic
1019247065 6:170716109-170716131 TATGCTACAAAGGGTCTTGAAGG - Intergenic
1020365325 7:7374491-7374513 CATGCTATGAAAGCTTTTGAGGG + Intronic
1020382523 7:7562650-7562672 TATTCTAGAAAAGTTTTTGAAGG + Intergenic
1022921639 7:35022062-35022084 AAGGCTAGAAAAGCTCTTTAGGG - Intronic
1023436179 7:40142864-40142886 TATACTAGAGATGCTGTTAAAGG - Intronic
1023464805 7:40442590-40442612 TTTACTAGAAAAGTTGTTGATGG + Intronic
1023486065 7:40688025-40688047 TATTCAATAAAAACTGTTGAAGG - Intronic
1023799669 7:43822909-43822931 TATGGTAGAGATGCTGTTAAAGG + Intergenic
1026379924 7:69789069-69789091 TCTGCTTGAAAACTTGTTGATGG - Intronic
1028793860 7:94882363-94882385 TACACTAGAAATGCTGTTAAAGG + Intergenic
1030644189 7:112041377-112041399 TATGCTTAAAAATCTGTTAAAGG - Intronic
1031098401 7:117448404-117448426 TATACTAGAAAGGCTGTCTAGGG + Intergenic
1031459304 7:122026238-122026260 TAGGTTAGAGATGCTGTTGAAGG + Intronic
1032928541 7:136638123-136638145 TTTGCTTGAAATGCTGGTGAAGG - Intergenic
1033959880 7:146901840-146901862 TATGCAAGAAAAACTGTAAAGGG - Intronic
1035501076 8:91844-91866 TATGCTACAAAGGGTCTTGAAGG + Intergenic
1036713733 8:11100821-11100843 TATGCTACAAAAGCTTTTGTTGG + Intronic
1037181991 8:16018348-16018370 CATGCTAGATAAGCTTTTGTAGG - Intergenic
1041841550 8:62278150-62278172 TCTCCTAGAAAAGCTGCTGCAGG + Intronic
1044184431 8:89235212-89235234 TACACTAGAAATGCTGTTAAAGG - Intergenic
1046457863 8:114491485-114491507 TATGCTTAAAAACGTGTTGAGGG + Intergenic
1046595867 8:116260442-116260464 TATGTGAGAAAAGCTGCTGGTGG - Intergenic
1046883573 8:119337819-119337841 TATGCTTAAAAAGATGTTGGAGG - Intergenic
1049016384 8:139923026-139923048 TCTTCTACAAAAGCTGTTGTAGG - Intronic
1052969596 9:34369258-34369280 TTTGCTACCAGAGCTGTTGATGG + Exonic
1056301447 9:85246100-85246122 TATGCCTTAAAAGCTGATGAAGG - Intergenic
1058986905 9:110217002-110217024 TATCCTATAAAAGATATTGAAGG + Intergenic
1061415263 9:130444148-130444170 TGAGGTAGAGAAGCTGTTGAAGG + Intergenic
1203792448 EBV:159130-159152 TACGCTGTAGAAGCTGTTGAAGG + Intergenic
1203607836 Un_KI270748v1:71568-71590 TATGCTACAAAGGGTCTTGAAGG - Intergenic
1188717218 X:33475053-33475075 TATACTAGAAAAGATGTTTAAGG - Intergenic
1189522596 X:41785326-41785348 TTTGCCAGAAAAGATTTTGAAGG + Intronic
1190603177 X:52113085-52113107 TATGCTAAAAGAGCTCCTGACGG + Intergenic
1195316653 X:103686253-103686275 TATTCTAGGAAAGAAGTTGATGG + Intronic
1199516838 X:148687471-148687493 CATACTAGAAAAAATGTTGAAGG + Intronic
1200683326 Y:6238518-6238540 TATGCTAGAAAGCCTGATGTAGG + Intergenic
1200887801 Y:8287119-8287141 TATGCTGGAAAACCTGATGTAGG - Intergenic
1201049308 Y:9915867-9915889 TATGCTAGAAAGCCTGATGTAGG - Intergenic